Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00008608
Source Database: WormBase (WB)
Affected Genes: WBGene00000440(ceh-17)
Genomic Alteration: WBGene00000440(ceh-17)
Availability: available
Source References: PMID:32811254, PMID:36652499, PMID:36924492, PMID:39738055, PMID:40114851
Synonyms: ceh-17(np1) I.
Alternate IDs: WB-STRAIN:IB16, CGC_IB16
Notes: Mutagen:UV/TMP|"Supplementary_genotype ceh-17(np1) I"|"WBStrain mapped, WBPaper00060107 added based on AFP_Strain data."|"WT behavioral phenotype. Axon guidance defect in ceh-17 expressing neurons ALA and 4SIA. ceh-17 = D1007.1, a C. elegans paired homeodomain transcription factor, Phox2 orthologue. np1 is a molecular null. np1 is a 1353 bp deletion inculding 549 bp upstream of the initiator ATG and extending to the 5th codon of the homeodomain. [NOTE: Miyazaki, et al. (2022) report that this strain carries the fln-2(ot611) mutation in the background, and outcrossing the strain resulted in significantly reduced quiescence during lethargus.]"
Proper citation: RRID:WB-STRAIN:WBStrain00008608 Copy
http://www.wormbase.org/db/get?name=WBStrain00047070
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:24613396
Synonyms: blmp-1(tm548) I.
Notes: Batch Strain object requested via get_NS_ids.pl
Proper citation: RRID:WB-STRAIN:WBStrain00047070 Copy
http://www.wormbase.org/db/get?name=WBStrain00047111
Source Database: WormBase (WB)
Affected Genes: WBGene00000912(daf-16)
Genomic Alteration: WBGene00000912(daf-16)
Availability: unknown
Source References: PMID:34505574
Synonyms: daf-16(ot853[daf-16::linker::mNG::3xFlag::AID]) I.
Notes: Batch Strain object. This strain is detailed in micropub-biology-000210|"mNeonGreen tag inserted into endogenous daf-16 locus; AID at 3' end of mNeonGreen. Transgene can be degraded in a background expressing TIR1 co-factor and supplemented with auxin, allowing conditional knock-down of daf-16 expression. Reference: Bhattacharya et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. PMID: 30686580"
Proper citation: RRID:WB-STRAIN:WBStrain00047111 Copy
http://www.wormbase.org/db/get?name=WBStrain00047307
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:32550518, PMID:34585102
Synonyms: EMPTY
Notes: Non-elegans Strain|"[2020-05-21T23:48:12.911Z WBPerson712] New Strain: C. tropicalis WBPaper00059661"
Proper citation: RRID:WB-STRAIN:WBStrain00047307 Copy
http://www.wormbase.org/db/get?name=WBStrain00047257
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33677541, PMID:37651423, PMID:37773960, PMID:38483995
Synonyms: reSi1[col-10p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] I:-5.32
Notes: Made_by: Tam Duong|"reSi1 [col-10p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Hypodermal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in hypodermal nuclei."|"Supplementary_genotype reSi1 [col-10p::TIR1::F2A::mTagBFP2:: AID*::NLS::tbb-2 3'UTR] I"|"Supplementary_genotype reSi1[Pcol-10::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR]"|"WBStrain mapped, WBPaper00061130 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00047257 Copy
http://www.wormbase.org/db/get?name=WBStrain00047291
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: goeEx737.
Notes: goeEx737 [flp-24p::SL1::GCaMP3.35-SL2::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. ALA-specific expression of GCaMP with an additional mKate marker for expression reference. Pick mKate+ to maintain. High transmission rate (>99%). Reference: Konietzka et al. 2019. Current Biology (accepted).|"Made_by: Dr. Jan Konietzka"
Proper citation: RRID:WB-STRAIN:WBStrain00047291 Copy
http://www.wormbase.org/db/get?name=WBStrain00047527
Source Database: WormBase (WB)
Affected Genes: WBGene00002276(lem-3)
Genomic Alteration: WBGene00002276(lem-3)
Availability: unknown
Source References: EMPTY
Synonyms: lem-3(tm3468) I.
Notes: Homozygous viable. Increased embryonic lethality after irradiation.|"Made_by: S. Mitani/NBRP"
Proper citation: RRID:WB-STRAIN:WBStrain00047527 Copy
http://www.wormbase.org/db/get?name=WBStrain00047686
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00021868(atln-1)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00021868(atln-1)
Availability: unknown
Source References: EMPTY
Synonyms: atln-1(gk5537[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV.
Notes: Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 4161 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AATTCTCCATTATCCGGATTCTCGTGGCGT; Right flanking sequence: TGGAACGGTTGGAATCTGATTTGCAGGTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00047686 Copy
http://www.wormbase.org/db/get?name=WBStrain00047778
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:32209461
Synonyms: metr-1(ok521) II Pf53f4.13::GFP Posm-10::mCherry (yadIs48) II
Notes: Imported from supporting material
Proper citation: RRID:WB-STRAIN:WBStrain00047778 Copy
http://www.wormbase.org/db/get?name=WBStrain00047846
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:32666045
Synonyms: let-23(sa62)gf inIs179[ida-1p::gfp] II; sbp-1(ep79) III; pnc-1(pk9605) IV
Notes: [2020-07-28T18:21:36.919Z WBPerson2987] New Strain: WBPaper00059770, genotype: let-23(sa62)gf inIs179[ida-1p::gfp] II; sbp-1(ep79) III; pnc-1(pk9605) IV
Proper citation: RRID:WB-STRAIN:WBStrain00047846 Copy
http://www.wormbase.org/db/get?name=WBStrain00047966
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33005883
Synonyms: gld-2(q497) gld-1(q485)/hT2::gfp [bli-4(e937) let-?(q782) qIs48] (I); ieSi64 [gld-1p::TIR1::mRuby::gld-1 3 Prime UTR + Cbr-unc-119(+)] (II); glp-1(ar202)/hT2::gfp [bli-4(e937) let-?(q782) qIs48] (III); lag-1(oz536oz537[lag-1::degron::3xHA]) (IV)
Notes: [2020-09-17T03:28:57.633Z WBPerson712] New Strain: DOI10.17912/micropub.biology.000310 WBPaper00060255 BS5629: gld-2(q497) gld-1(q485)/hT2::gfp [bli-4(e937) let-?(q782) qIs48] (I); ieSi64 [gld-1p::TIR1::mRuby::gld-1 3 Prime UTR + Cbr-unc-119(+)] (II); glp-1(ar202)/hT2::gfp [bli-4(e937) let-?(q782) qIs48] (III); lag-1(oz536oz537[lag-1::degron::3xHA]) (IV)
Proper citation: RRID:WB-STRAIN:WBStrain00047966 Copy
http://www.wormbase.org/db/get?name=WBStrain00040476
Source Database: WormBase (WB)
Affected Genes: WBGene00004178(prg-1)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00004178(prg-1), WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: prg-1(tm872) I; neSi14 II; unc-119(ed3) III.
Alternate IDs: WB-STRAIN:WM274, CGC_WM274
Notes: neSi14 [FLAG::prg-1 + Cbr-unc-119(+)] II. MosSCI insertion into ttTi5605 (LG II). Reference: Lee HC, et al. Cell. 2012 Jul 6;150(1):78-87.
Proper citation: RRID:WB-STRAIN:WBStrain00040476 Copy
http://www.wormbase.org/db/get?name=WBStrain00040478
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: rde-3(ne3370) I.
Alternate IDs: WB-STRAIN:WM286, CGC_WM286
Notes: Made_by: Gisela Chen|"RNAi deficient. Temperature-sensitive sterile. In-frame deletion. Reference: Chen CC, et al. Curr Biol. 2005 Feb 22;15(4):378-83."
Proper citation: RRID:WB-STRAIN:WBStrain00040478 Copy
http://www.wormbase.org/db/get?name=WBStrain00040403
Source Database: WormBase (WB)
Affected Genes: WBGene00006496(cgef-1)
Genomic Alteration: WBGene00006496(cgef-1)
Availability: available
Source References: EMPTY
Synonyms: cgef-1(gk261) X; ojIs40.
Alternate IDs: WB-STRAIN:WH527, CGC_WH527
Notes: ojIs40 [wsp-1(G-protein-Binding-Domain)::GFP + unc-119(+)]. Maintain under normal condition. Reference: Kumfer et al. (2010) Mol Bio Cell21(2):266-77.
Proper citation: RRID:WB-STRAIN:WBStrain00040403 Copy
http://www.wormbase.org/db/get?name=WBStrain00040431
Source Database: WormBase (WB)
Affected Genes: WBGene00000405(cdk-1)
Genomic Alteration: WBGene00000405(cdk-1)
Availability: available
Source References: PMID:33397943, PMID:40410380
Synonyms: cdk-1(ne2257) III.
Alternate IDs: WB-STRAIN:WM99, CGC_WM99
Notes: Maintain at 15C. Produces dead eggs at 25C.|"WBStrain mapped, WBPaper00060839 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00040431 Copy
http://www.wormbase.org/db/get?name=WBStrain00040446
Source Database: WormBase (WB)
Affected Genes: WBGene00018921(sago-2)
Genomic Alteration: WBGene00018921(sago-2)
Availability: available
Source References: PMID:39331715
Synonyms: sago-2(tm894) I.
Alternate IDs: WB-STRAIN:WM154, CGC_WM154
Notes: Made_by: Yigit/Mello|"Somatic RNAi deficient."
Proper citation: RRID:WB-STRAIN:WBStrain00040446 Copy
http://www.wormbase.org/db/get?name=WBStrain00040414
Source Database: WormBase (WB)
Affected Genes: WBGene00004323(rde-1)
Genomic Alteration: WBGene00004323(rde-1)
Availability: available
Source References: PMID:10535731, PMID:31300558, PMID:32943454, PMID:33319173, PMID:38232128, PMID:38980902
Synonyms: rde-1(ne219) V.
Alternate IDs: WB-STRAIN:WM27, CGC_WM27
Notes: Generated from papers flagged positive during the last month for data type afp_strain/other_strain.|"Made_by: Tabara and Mello"|"Mutagen:Ems"|"RNAi deficient."|"WBStrain provided so WBPaper00060343 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00040414 Copy
http://www.wormbase.org/db/get?name=WBStrain00040422
Source Database: WormBase (WB)
Affected Genes: WBGene00000106(alg-2)
Genomic Alteration: WBGene00000106(alg-2)
Availability: available
Source References: PMID:38471816, PMID:38477356, PMID:38573858
Synonyms: alg-2(ok304) II
Alternate IDs: WB-STRAIN:WM53, CGC_WM53
Notes: Made_by: Barstead|"T07D3.7. Homozygous viable, contains an out of frame deletion removing nucleotides encoding amino acids 34-374. This strain cannot be distributed to for-profit companies. Do not distribute this strain; other labs should request it from the CGC. URL: URL: www.celeganskoconsortium.omrf.org."
Proper citation: RRID:WB-STRAIN:WBStrain00040422 Copy
http://www.wormbase.org/db/get?name=WBStrain00040596
Source Database: WormBase (WB)
Affected Genes: WBGene00003563(ncs-1)
Genomic Alteration: WBGene00003563(ncs-1)
Availability: available
Source References: EMPTY
Synonyms: ncs-1(qa401) X.
Alternate IDs: WB-STRAIN:XA406, CGC_XA406
Notes: Defective thermotaxis. [NOTE (04-15-2013): the genotype of XA406 has been corrected to ncs-1(qa401). It was previously described as ncs-1(qa406).]
Proper citation: RRID:WB-STRAIN:WBStrain00040596 Copy
http://www.wormbase.org/db/get?name=WBStrain00040524
Source Database: WormBase (WB)
Affected Genes: WBGene00002042(hus-1)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00002042(hus-1), WBGene00006843(unc-119)
Availability: available
Source References: PMID:31717869
Synonyms: hus-1(op241) I; unc-119(ed3) III; opIs34.
Alternate IDs: WB-STRAIN:WS1433, CGC_WS1433
Notes: opIs34 [hus-1p::hus-1::GFP + unc-119(+)]. Low-copy integrated array of 1144 bp hus-1 promoter and genomic coding sequence fused to GFP. Nuclear expression of GFP in germ cells and embryos. Integrated GFP construct completely rescues DNA damage induced cell cycle arrest defect and partially rescues DNA damage induced apoptosis of hus-1(op241).|"Reference WBPaper00058851 added based on published strain data identified by Textpresso literature search."
Proper citation: RRID:WB-STRAIN:WBStrain00040524 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
