Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 54 showing 1061 ~ 1080 out of 1,464 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:RGD_40924656

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=40924656

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown (as of 2021-01-19)
Alternate IDs: 40924656
Notes: Established as congenics by introducing fa from 13M/Vc to BN/Crl

Proper citation: RRID:RGD_40924656 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=151356945

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 151356945
Notes: Two DNA expression constructs, the bacterial tetracyclin repressor (TetR) under the expression control of human EF1a promoter and the improved Cre recombinase (iCre) under Fos promoter were joined in an antiparallel orientation in one rat ROSA26 targeting cassette. The DNA construct, together with CRISPR /Cas9 system, was injected to one cell Long-Evans (Crl:LE) rat embryos and founders were identified and bred for 8 generations at at NIDA IRP (Hope lab).

Proper citation: RRID:RGD_151356945 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=152999002

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 152999002
Notes: Heterozygous KO of the Fxn gene obtained by targeting exon 4 with CRISPR/Cas9 system This strain has been deposited with RRRC Rat Resource and Research Center

Proper citation: RRID:RGD_152999002 Copy   


  • RRID:RGD_152999000

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=152999000

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 152999000
Notes: Heterozygous KO of the Fxn gene obtained by targeting exon 4 with CRISPR/Cas9 system This strain has been deposited with RRRC

Proper citation: RRID:RGD_152999000 Copy   


  • RRID:RGD_127284870

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=127284870

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 127284870
Notes: This strain was established by injecting Zinc-finger nucleases (ZFNs) to F344/Stm pronuclear stage embryos. Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C (target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). The injected F344/Stm embryos were transferred into the oviducts of pseudopregnant rats. Four lines of knockout strains were estaglished. This F344-Nppcem3Kyo strain ( delta 11)was deduced to generated a frame shift and a premature stop codon (at nucleotides 275 - 277, NM_053750.1) National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_127284870 Copy   


  • RRID:RGD_150521559

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150521559

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 150521559
Notes: Male SD rats were treated with the mutagen N-ethyl-N-nitrosourea (60 mg/kg intraperitoneally) at ages 9 and 10 weeks. A heterozygous mutant founder carrying a T to C transition that encoded a substitution of a proline residue (CCA) for a highly conserved serine residue (TCA) at amino acid position 94 was identified. This mutant male was mated to a LEW female and phenotyping by the expression of CD8a and CD8ab.

Proper citation: RRID:RGD_150521559 Copy   


  • RRID:RGD_126848804

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=126848804

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 126848804
Notes: The Sleeping Beauty transposon system was used to insert the sleeping beauty transposon into the first intron of the rat Trpc4 gene. Trpc4 knock-out (510 bp) and wild-type allele (905 bp) were confirmed using PCR and gel electrophoresis

Proper citation: RRID:RGD_126848804 Copy   


  • RRID:RGD_38676255

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38676255

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2020-09-16)
Alternate IDs: 38676255
Notes: TALEN (Left: ttcagAATGATTCATGGG, Right : ACGCACTCTTCAAAGCTA) targeting the exon4 of hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. A 18-bp deletion in the exon4 of Hcn1 gene. It is predicted that 6 amino-acid deleted HCN1 protein is expressed. National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_38676255 Copy   


  • RRID:RGD_150521708

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150521708

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 150521708
Notes: The Sleeping Beauty transposon-mediated mutagenesis was used to knock out the rat Tbc1d1 gene in in rat spermatogonial stem cells from Sprague Dawley.

Proper citation: RRID:RGD_150521708 Copy   


  • RRID:RGD_38676250

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38676250

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2020-09-16)
Alternate IDs: 38676250
Notes: TALEN (Left:ttcagAATGATTCATGGG, Right:ACGCACTCTTCAAAGCTA)targeting the exon4 of hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. A 13-bp deletion in the exon4 of Hcn1 gene: as a result of frameshift mutation, stop codon is produced. Decreased expression levels of Hcn1 gene and HCN1 protein. National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_38676250 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=14402421

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 14402421
Notes: The Zinc Finger Nuclease system was used to knock-in SNP rs16969968 in exon 5 (D398N) thus created a missense mutation. The embryos were from breeding of Long Evans from Janvier Labs (RjOrl:LE) and reimplanted to foster mother Dark Agouti (Janvier). Heterozygous rats are currently bred to generate heterozygous and homozygous.

Proper citation: RRID:RGD_14402421 Copy   


  • RRID:RGD_329322880

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=329322880

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2023-04-24)
Alternate IDs: 329322880
Notes: The gRNA to rat Mertk gene, and Cas9 mRNA were co-injected into fertilized rat eggs to generate targeted knockout offspring. F0 founder animals were identified by PCR followed by sequence analysis, which were bred to wildtype rat to test germline transmission and F1 animal generation. This strain was derived from founder 6# carrying a 13934 deletion which included exons 3 to 5. Cyagen Biosciences (Guangzhou) Inc.Building D, 3rd Floor, 3 Juquan Road, Science City, Guangzhou, 510663, China

Proper citation: RRID:RGD_329322880 Copy   


  • RRID:RGD_155900757

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155900757

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-02-09)
Alternate IDs: 155900757
Notes: Using CRISPR/Cas9 genomic engineering in rats via homologous end-joining in fertilized embryos, we have knocked'in a humanized CHRNA6 3'UTR in place of the natural CHRNA6 3'UTR of the Sprague Dawley rat line. This new genetically modified CHRNA6C123G humanized rat line carries a homozygous CC nucleotide modification at position 123 within the CHRNA6 gene 3'UTR. The laboratory has deposited these strains with the RRRC.

Proper citation: RRID:RGD_155900757 Copy   


  • RRID:RGD_155900755

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155900755

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-02-09)
Alternate IDs: 155900755
Notes: Using CRISPR/Cas9 genomic engineering in rats via homologous end-joining in fertilized embryos, we have knocked'in a humanized CHRNA6 3'UTR in place of the natural CHRNA6 3'UTR of the Sprague Dawley rat line. This new genetically modified CHRNA6C123G humanized rat line carries a homozygous GG nucleotide modification at position 123 within the CHRNA6 gene 3'UTR. The laboratory has deposited these strains with the RRRC.

Proper citation: RRID:RGD_155900755 Copy   


  • RRID:RGD_158013766

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=158013766

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 158013766
Notes: This Akt mutant strain was created in zygotes from Holtzman Sprague-Dawley. Guided RNAs targeting exon 4 (target sequence: GCCGTTTGAGTCCATCAGCC; nucleotides 356-375) and exon 7 (target sequence: TTGTCATGGAGTACGCCAAT; nucleotides 712-731) of the Akt1 gene (NM_033230.3) were injected to the embryos to create a1332-bp deletion from exon 4 to exon7, resulting a premature stop of the protein.

Proper citation: RRID:RGD_158013766 Copy   


  • RRID:RGD_155631259

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155631259

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 155631259
Notes: These mutants were found in Sprague-Dawley rats at University of Puebla in 1989. A spontaneous neurological mutation was detected in a colony of Sprague Dawley rats. The animals developed a progressive neurological syndrome characterized by tremor (which appeared at the age of 1 month), ataxia (at 4 months), immobility episodes (after 5-6 months), audiogenic seizures and hindlimb paralysis (after 10 months). Cross breeding experiments indicate that this is an autosomal recessive mutation, The rat line was named taiep (tremor, ataxia, tonic immobility episodes, epilepsy and paralysis) rats.

Proper citation: RRID:RGD_155631259 Copy   


  • RRID:RGD_155631293

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155631293

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 155631293
Notes: The rat mutant was generated by pronuclear microinjection of Sprague-Dawley rat zygotes with a mixture of Cas9/Cas9 system to target the region in the rat Pde3a gene homologous to the human T445N mutation. The rat model exhibits a 9-bp deletion within the conserved 15-bp regulatory region that leads to the loss of 3 amino acids (aa 441-443 analogous to human PDE3A aa 444-446).

Proper citation: RRID:RGD_155631293 Copy   


  • RRID:RGD_155631295

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155631295

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 155631295
Notes: The rat mutant was generated by pronuclear microinjection of Sprague-Dawley rat zygotes with a mixture of Cas9/Cas9 system to target the region in the rat Pde3a gene homologous to the human T445N mutation. The rat model exhibits a 20-bp deletion within the conserved 15-bp regulatory region that leads to n a frameshift and thus in a truncated and functionally deleted protein (functional DEL).

Proper citation: RRID:RGD_155631295 Copy   


  • RRID:RGD_288084582

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=288084582

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 288084582
Notes: This CRISPR/Cas9 induced mutation Phe54Leu is induced in embryos of F344/NSlc. The genome editing system targeting exon 3 of Txn1 gene ( (c. 160 T > C) was delivered into embryos by electroporation. The two-cell stage embryos were transferred into the oviducts of pseudopregnant females. The rat called Txn1-F54L rat, replicates Adem rats (RGD:288084580) which carried Phe54Leu mutation in the same gene.These two strains exhibit similar phenotype.

Proper citation: RRID:RGD_288084582 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=151665772

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo; Cryopreserved Sperm (as of 2022-04-01)
Alternate IDs: 151665772
Notes: The targeting vector was designed to replace the stop codon of Tfap2c with T2A-tdTomato. The adeno-associated virus carrying the targeting vector was infected to Crlj:WI (RGD ID: 2312504) rat 1 cell zygotes followed by the introduction of CRISPR/Cas9 ribonucleoprotein complex by electroporation. After incubation overnight, the zygotes were transferred into oviducts of pseudo-pregnant rats. The pups were judged correct gene-targeting by genomic PCR. These rat strains are being maintained by crossing the founder rats with Crlj:WI rats. The tdTomato fluorescence faithfully label Tfap2c expressing cells. Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi 444-8787, Japan. or Division of Mammalian Embryology, Center for Stem Cell Biology and Regenerative Medicine, The Institute for Medical Science, The University of Tokyo, Tokyo108-8639, Japan.

Proper citation: RRID:RGD_151665772 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X