Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Background:mutant (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

1,464 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
SS-Kcnmb1em3Mcwi
 
Resource Report
Resource Website
RRID:RGD_6893444 Rattus norvegicus This strain was produced by injecting ZFNs targeting the sequence AGCTGCATCATAAACACCttcatcATTGGGGCAGCCTTGGCA into SS/JrHsdMcwi rat embryos. The resulting allele is a 21-bp deletion in exon 2 and intron 2. 6893444 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2017-01-26) 6893444 2026-09-19 01:18:39 0
SS-Grm7em2Mcwi
 
Resource Report
Resource Website
RRID:RGD_6893441 Rattus norvegicus This strain was produced by injecting ZFNs targeting the sequence ATCCGCCATGTTAACTTCaatggTAAGACTCCAATGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in exon 3. 6893441 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2017-01-26) 6893441 2026-09-19 01:18:39 0
SS-Ppargem1Mcwi
 
Resource Report
Resource Website
RRID:RGD_6893442 Rattus norvegicus This strain was produced by injecting ZFNs targeting the sequence TGCCATTCTGGCCCAccaactTCGGAATCAGCTCTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a a 133-bp deletion of (RGSC 5.0/rn5): chr4:210,640,676-210,640,808, including part of intron 1 and exon 2 of isoform NM_013124.3 6893442 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2017-01-26) 6893442 2026-09-19 01:18:39 0
SD-Nfe2l2em1Mcwi
 
Resource Report
Resource Website
RRID:RGD_9588552 Rattus norvegicus This strain was produced by injecting TALENs targeting the sequence TAGTCCTGGCGGTGGCAATTCCAAGTCCATCATGCTGAGGGCGGACGCTGCGCTA into Crl:SD Sprague Dawley rat embryos. The resulting mutation is a 41-bp deletion in exon 1. 9588552 mutant Rat Genome Database (RGD) RGD Live Animals (as of 2017-01-26) 9588552 2026-09-19 01:18:40 0
LE-Lrrk2em1Sage
 
Resource Report
Resource Website
RRID:RGD_7241050 Rattus norvegicus This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 30. Horizon Discovery 7241050 mutant Rat Genome Database (RGD) RGD Live Animals (as of 2017-06-06) 7241050 2026-09-19 01:18:41 0
SHR-Ndufc2em1Mcwi
 
Resource Report
Resource Website
RRID:RGD_9588544 Rattus norvegicus This strain was produced by injecting ZFNs targeting the sequence GGCTTCCTGGGCTACTGCacgggcCTGATGGACAACATG into SHR/NCrl rat embryos. The resulting mutation is a 9-bp deletion in exon 1. 9588544 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2017-01-26) 9588544 2026-09-19 01:18:40 0
SHR-Ndufc2em2Mcwi
 
Resource Report
Resource Website
RRID:RGD_9588546 Rattus norvegicus This strain was produced by injecting ZFNs targeting the sequence GGCTTCCTGGGCTACTGCacgggcCTGATGGACAACATG into SHR/NCrl rat embryos. The resulting mutation is a net 107-bp deltion in exon 1. 9588546 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2017-01-26) 9588546 2026-09-19 01:18:40 0
F344-Il2rgem1Kyo
 
Resource Report
Resource Website
1+ mentions
RRID:RGD_9685625 Rattus norvegicus The strain having a zinc finger nuclease-induced 660-bp deletion mutation in Il2rg gene shows severe combined immunodeficiency and grows normally under SPF condition. National BioResource Project for the Rat in Japan 9685625 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2017-03-27) 9685625 2026-09-19 01:18:40 1
LEW-Rag1em1Ztm
 
Resource Report
Resource Website
RRID:RGD_7204133 Rattus norvegicus This strain was produced by injecting ZFNs into LEW/Ztm rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 2. 7204133 mutant Rat Genome Database (RGD) RGD Unknown 7204133 2026-09-19 01:18:40 0
SD-Pax6Sey2/Mce
 
Resource Report
Resource Website
RRID:RGD_9685623 Rattus norvegicus This rat (developed spontaneous microphthalmia) was found in a SD rat colony at Yamanouchi Pharma Inc. (Astellas Pharma Inc.)Genomic DNA analysis from mutants revealed a single base(c) insertion, resulting in a abnormal stop codon at 33-bp downstream from the insertion site due to frameshift. National BioResource Project for the Rat in Japan 9685623 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2017-02-23) 9685623 2026-09-19 01:18:40 0
F344-Il2rgem7Kyo
 
Resource Report
Resource Website
RRID:RGD_8552331 Rattus norvegicus The strain having a Endonuclease-induced 7 bp deletion mutation in the 2nd exon of the rat Il2rg gene was established by TAL effector nuclease obtained from Dr. Yamamoto at Hiroshima University. National BioResource Project for the Rat in Japan 8552331 mutant Rat Genome Database (RGD) RGD Unknown 8552331 2026-09-19 01:18:40 0
KHR/Kyo-/+
 
Resource Report
Resource Website
RRID:RGD_7800705 Rattus norvegicus Kaken hairless rat were detected by Kimura from Gunn's rat at Kaken Pharmaceuticals in 1987. 2002 introduced to Kyoto University (F36). National BioResource Project for the Rat in Japan 7800705 mutant Rat Genome Database (RGD) RGD Cryopreserved Embryo; Cryopreserved Sperm 7800705 2026-09-19 01:18:40 0
F344-Lepm1Kyo
 
Resource Report
Resource Website
RRID:RGD_8549776 Rattus norvegicus Established by ENU mutagenesis in F344/NSlc rats. This strain has Lep missense mutation (Q92X). National BioResource Project for the Rat in Japan 8549776 mutant Rat Genome Database (RGD) RGD Live Animals (as of 2017-03-17) 8549776 2026-09-19 01:18:41 0
LE-Lrrk1em1Sage-/-
 
Resource Report
Resource Website
RRID:RGD_7241057 Rattus norvegicus ZFN mutant founders carrying a 19-bp frameshift deletion in exon 4 were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous. Horizon Discovery 7241057 mutant Rat Genome Database (RGD) RGD Unknown 7241057 2026-09-19 01:18:41 0
LE-Lrrk2em1Sage-/-
 
Resource Report
Resource Website
1+ mentions
RRID:RGD_7241056 Rattus norvegicus ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offspring which were intercrossed and offsprings maintained as homozygous Sigma Advanced Genetic Engineering Labs 7241056 mutant Rat Genome Database (RGD) RGD Live Animals (as of 2018-08-24) 7241056 2026-09-19 01:18:41 1
LE-Pink1em1Sage
 
Resource Report
Resource Website
RRID:RGD_7241054 Rattus norvegicus This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 26-bp frameshift deletion in exon 4. Sigma Advanced Genetic Engineering Labs 7241054 mutant Rat Genome Database (RGD) RGD Unknown 7241054 2026-09-19 01:18:41 0
F344.Cg-Du, TyrCKyo+/+
 
Resource Report
Resource Website
RRID:RGD_7800661 Rattus norvegicus Developed by the DEPOSITOR National BioResource Project for the Rat in Japan 7800661 mutant Rat Genome Database (RGD) RGD Unknown 7800661 2026-09-19 01:18:42 0
F344-Il2rgem3Kyo
 
Resource Report
Resource Website
RRID:RGD_9685750 Rattus norvegicus This strain shows severe combined immunodeficiency caused by a 332 bp deletion in Il2rg gene and grow normally under SPF condition. National BioResource Project for the Rat in Japan 9685750 mutant Rat Genome Database (RGD) RGD Unknown 9685750 2026-09-19 01:18:41 0
DA-Tyrem2Kyo
 
Resource Report
Resource Website
RRID:RGD_8552303 Rattus norvegicus Developed by the DEPOSITOR National BioResource Project for the Rat in Japan 8552303 mutant Rat Genome Database (RGD) RGD Live Animals; Cryopreserved Sperm 8552303 2026-09-19 01:18:42 0
F344-Lgi1m1Kyo
 
Resource Report
Resource Website
RRID:RGD_8552275 Rattus norvegicus Developed by gene driven ENU mutagenesis in F344/NSlc rats. Lgi1-mutant rats carrying a missense mutation (c.1154 T > G)(L385R). National BioResource Project for the Rat in Japan 8552275 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2017-03-17) 8552275 2026-09-19 01:18:42 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.