Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00036258
Source Database: WormBase (WB)
Affected Genes: WBGene00004273(rab-10)
Genomic Alteration: WBGene00004273(rab-10)
Availability: available
Source References: PMID:38302462
Synonyms: rab-10(ok1494) I.
Alternate IDs: WB-STRAIN:VC1026, CGC_VC1026
Notes: Mutagen:UV/TMP|"T23H2.5. Superficially wild type."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036258 Copy
http://www.wormbase.org/db/get?name=WBStrain00036261
Source Database: WormBase (WB)
Affected Genes: WBGene00003085(ccar-1)
Genomic Alteration: WBGene00003085(ccar-1)
Availability: available
Source References: EMPTY
Synonyms: ccar-1(gk433) IV.
Alternate IDs: WB-STRAIN:VC1029, CGC_VC1029
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y37A1B.1a. Superficially wild type."
Proper citation: RRID:WB-STRAIN:WBStrain00036261 Copy
http://www.wormbase.org/db/get?name=WBStrain00036232
Source Database: WormBase (WB)
Affected Genes: WBGene00002131(inx-9)
Genomic Alteration: WBGene00002131(inx-9)
Availability: available
Source References: EMPTY
Synonyms: inx-9(ok1502) IV.
Alternate IDs: WB-STRAIN:VC994, CGC_VC994
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK792.3. Superficially wild type."
Proper citation: RRID:WB-STRAIN:WBStrain00036232 Copy
http://www.wormbase.org/db/get?name=WBStrain00036241
Source Database: WormBase (WB)
Affected Genes: WBGene00006912(vha-3)
Genomic Alteration: WBGene00006912(vha-3)
Availability: available
Source References: PMID:32302543, PMID:37644339, PMID:37957360
Synonyms: vha-3(ok1501) IV.
Alternate IDs: WB-STRAIN:VC1003, CGC_VC1003
Notes: Mutagen:UV/TMP|"Supplementary_genotype vha-3(ok1501) IV"|"Supplementary_genotype [vha-3(ok1501)]"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00059578 added based on AFP_Strain data."|"Y38F2AL.4. Superficially wild type. External left primer: GGTGAAAAATCGGGGAAAAT. External right primer: GCGATGACAACTATTGGGCT. Internal left primer: TTTAGCTCAAAATTTGCCCG. Internal right primer: ATGTGCTGCGACTTCCTTCT. Internal WT amplicon: 2580 bp. Deletion size: 710 bp."
Proper citation: RRID:WB-STRAIN:WBStrain00036241 Copy
http://www.wormbase.org/db/get?name=WBStrain00036246
Source Database: WormBase (WB)
Affected Genes: WBGene00016943(acdh-1)
Genomic Alteration: WBGene00016943(acdh-1)
Availability: available
Source References: PMID:32560629, PMID:37043428, PMID:38418585
Synonyms: acdh-1(ok1489) I.
Alternate IDs: WB-STRAIN:VC1011, CGC_VC1011
Notes: C55B7.4. Superficially wild type.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036246 Copy
http://www.wormbase.org/db/get?name=WBStrain00036219
Source Database: WormBase (WB)
Affected Genes: WBGene00007615(set-31)
Genomic Alteration: WBGene00007615(set-31)
Availability: available
Source References: EMPTY
Synonyms: set-31(ok1482) V.
Alternate IDs: WB-STRAIN:VC978, CGC_VC978
Notes: C15H11.5. Superficially wild type.|"Made_by: Anna Rankin"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036219 Copy
http://www.wormbase.org/db/get?name=WBStrain00036213
Source Database: WormBase (WB)
Affected Genes: WBGene00000067(act-5)|WBGene00001072(dpy-10)
Genomic Alteration: WBGene00000067(act-5), WBGene00001072(dpy-10)
Availability: available
Source References: PMID:38190406
Synonyms: +/mT1 II; act-5(ok1397)/mT1 [dpy-10(e128)] III.
Alternate IDs: WB-STRAIN:VC971, CGC_VC971
Notes: Mutagen:UV/TMP|"T25C8.2. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1397 homozygotes (arrest stage/phenotype undetermined; may be sterile adult). Pick WT and check for correct segregation of progeny to maintain."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036213 Copy
http://www.wormbase.org/db/get?name=WBStrain00036222
Source Database: WormBase (WB)
Affected Genes: WBGene00001835(hda-2)
Genomic Alteration: WBGene00001835(hda-2)
Availability: available
Source References: EMPTY
Synonyms: hda-2(ok1479) II.
Alternate IDs: WB-STRAIN:VC983, CGC_VC983
Notes: C08B11.2. Superficially wild type.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036222 Copy
http://www.wormbase.org/db/get?name=WBStrain00036221
Source Database: WormBase (WB)
Affected Genes: WBGene00001499(fsn-1)
Genomic Alteration: WBGene00001499(fsn-1)
Availability: available
Source References: EMPTY
Synonyms: fsn-1(gk429) III.
Alternate IDs: WB-STRAIN:VC980, CGC_VC980
Notes: C26E6.5. Superficially wild type.|"Made_by: Vancouver KO Group"|"Mutagen:TMP+UV"|"Mutagen:TMP/UV"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036221 Copy
http://www.wormbase.org/db/get?name=WBStrain00036293
Source Database: WormBase (WB)
Affected Genes: WBGene00022516(mtx-2)
Genomic Alteration: WBGene00022516(mtx-2)
Availability: available
Source References: EMPTY
Synonyms: mtx-2(gk444) III.
Alternate IDs: WB-STRAIN:VC1064, CGC_VC1064
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZC97.1. Superficially wild type."
Proper citation: RRID:WB-STRAIN:WBStrain00036293 Copy
http://www.wormbase.org/db/get?name=WBStrain00036292
Source Database: WormBase (WB)
Affected Genes: WBGene00003753(nlp-15)
Genomic Alteration: WBGene00003753(nlp-15)
Availability: available
Source References: PMID:38573858
Synonyms: nlp-15(ok1512) I.
Alternate IDs: WB-STRAIN:VC1063, CGC_VC1063
Notes: CC4.2. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036292 Copy
http://www.wormbase.org/db/get?name=WBStrain00036359
Source Database: WormBase (WB)
Affected Genes: WBGene00006616(trp-4)
Genomic Alteration: WBGene00006616(trp-4)
Availability: available
Source References: PMID:31704915
Synonyms: trp-4(ok1605) I.
Alternate IDs: WB-STRAIN:VC1141, CGC_VC1141
Notes: Reference WBPaper00058832 added based on published strain data identified by Textpresso literature search.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y71A12B.4. Superficially wild type. External left primer: AAGACTCCGGTACACGTTGC. External right primer: AGAAGCATCCGCACAAGACT. Internal left primer: AAGTTTGGTGGCTCAATTCG. Internal right primer: CTTTGAGCGGCTAAATGGAG. Internal WT amplicon: 3332 bp. Deletion size: 1027 bp. Deletion left flank: GGCCGAGGTTACTGGACCAGGACCAGGGCC. Deletion right flank: TTTTACCGATTTTTAGGCAGAATTGATTTT."
Proper citation: RRID:WB-STRAIN:WBStrain00036359 Copy
http://www.wormbase.org/db/get?name=WBStrain00036319
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00008877(rtcb-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00008877(rtcb-1)
Availability: available
Source References: PMID:33157031
Synonyms: rtcb-1(gk451) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC1094, CGC_VC1094
Notes: F16A11.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk451 homozygotes (sterile with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. May also segregate Bli non-GFP (hT2 homozygotes), which are the result of rare recombination. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCCCTTCTTCATCAATTCC. External right primer: ATAATTTCTCGGACCCGCTT. Internal left primer: GCGTAATGATTTCCTGCTCC. Internal right primer: CATCATCTTTCCACCACACG. Internal WT amplicon: 1913 bp. Deletion size: 370 bp. Deletion left flank: ATGATTCACTAACCGAATGTCCAACAATTC. Deletion right flank: ATCTCAAAATCTTTAGTCAAGAAAACATTC.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00060602 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00036319 Copy
http://www.wormbase.org/db/get?name=WBStrain00036329
Source Database: WormBase (WB)
Affected Genes: WBGene00003056(lon-2)|WBGene00003752(nlp-14)
Genomic Alteration: WBGene00003056(lon-2), WBGene00003752(nlp-14)
Availability: available
Source References: EMPTY
Synonyms: +/szT1 [lon-2(e678)] I; nlp-14(ok1517)/szT1 X.
Alternate IDs: WB-STRAIN:VC1108, CGC_VC1108
Notes: D1009.4. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1517 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036329 Copy
http://www.wormbase.org/db/get?name=WBStrain00036328
Source Database: WormBase (WB)
Affected Genes: WBGene00022235(sqd-1)
Genomic Alteration: WBGene00022235(sqd-1)
Availability: available
Source References: EMPTY
Synonyms: sqd-1(ok1582) IV/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC1106, CGC_VC1106
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y73B6BL.6. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1582 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain."
Proper citation: RRID:WB-STRAIN:WBStrain00036328 Copy
http://www.wormbase.org/db/get?name=WBStrain00036323
Source Database: WormBase (WB)
Affected Genes: WBGene00002008(hsp-4)
Genomic Alteration: WBGene00002008(hsp-4)
Availability: available
Source References: PMID:34407398, PMID:36924492
Synonyms: hsp-4(gk514) II.
Alternate IDs: WB-STRAIN:VC1099, CGC_VC1099
Notes: F43E2.8. Superficially wild type.|"Mutagen:UV/TMP"|"Supplementary_genotype hsp-4(gk514) II"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain provided so WBPaper00061805 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00036323 Copy
http://www.wormbase.org/db/get?name=WBStrain00036497
Source Database: WormBase (WB)
Affected Genes: WBGene00004884(smg-6)
Genomic Alteration: WBGene00004884(smg-6)
Availability: available
Source References: EMPTY
Synonyms: smg-6(ok1794) III.
Alternate IDs: WB-STRAIN:VC1305, CGC_VC1305
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y54F10AL.2. Superficially wild type. External left primer: TAGCTAGCCCATGTGCCTTT. External right primer: TTTTGCGATGTGAATCGTGT. Internal left primer: TTTTAGCCACACCATCCACA. Internal right primer: CCAAAAACATGGGAAAATCG. Internal WT amplicon: 3113 bp. Deletion size: 920 bp. Deletion left flank: CAATTAAAAATTTTTTTTCTTGATTTTCTA. Deletion right flank: AAAATTGTGTCTAGGGGTGAAAAATTGCGA."
Proper citation: RRID:WB-STRAIN:WBStrain00036497 Copy
http://www.wormbase.org/db/get?name=WBStrain00036424
Source Database: WormBase (WB)
Affected Genes: WBGene00002101(ins-18)
Genomic Alteration: WBGene00002101(ins-18)
Availability: available
Source References: EMPTY
Synonyms: ins-18(ok1672) I.
Alternate IDs: WB-STRAIN:VC1218, CGC_VC1218
Notes: T28B8.2. Superficially wild type. External left primer: TTCAGATTGCTCGAAAGGCT. External right primer: GCCATTGTATCCATCCCATC. Internal left primer: CGTCGCCACTATTCCAAAAT. Internal right primer: CGTATTTTGTGGGCGGTACT. Internal WT amplicon: 2143 bp. Deletion size: 940 bp. Deletion left flank: AAGCTGGTTTGTTTTCATGTTTGTAATACA. Deletion right flank: TTTGGCAATTGGCAATTATTTAATTCTTTT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036424 Copy
http://www.wormbase.org/db/get?name=WBStrain00036431
Source Database: WormBase (WB)
Affected Genes: WBGene00002222(klp-11)
Genomic Alteration: WBGene00002222(klp-11)
Availability: available
Source References: PMID:37463209, PMID:38302462
Synonyms: klp-11(tm324) IV.
Alternate IDs: WB-STRAIN:VC1228, CGC_VC1228
Notes: 331 bp deletion. T608 Stop. Flanking sequences: aaaatgagaaaaggaacaactgaattggac taatttttaaacacaaaacttactattgtt.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036431 Copy
http://www.wormbase.org/db/get?name=WBStrain00036435
Source Database: WormBase (WB)
Affected Genes: WBGene00003839(ocr-2)
Genomic Alteration: WBGene00003839(ocr-2)
Availability: available
Source References: PMID:36652499
Synonyms: ocr-2(ok1711) IV.
Alternate IDs: WB-STRAIN:VC1233, CGC_VC1233
Notes: T09A12.3. Superficially wild type. External left primer: TAGCATTTGTAAAACCCGGC. External right primer: AAAAACCCCCAATTTTCCTG. Internal left primer: CGAAAGCTTCAATGGGTGAT. Internal right primer: GGCTCCGAAAGCTTACCTCT. Internal WT amplicon: 2957 bp. Deletion size: 1512 bp.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036435 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.