Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
F344; W-Phf24em6(EGFP)Iexas Resource Report Resource Website |
RRID:RGD_38676453 | Rattus norvegicus | This strain (line No. 6) was establishe by CRISPR-Cas9 system at Osaka University and EGFP sequence was knock-in in Phf24 gene. Back ground strain is Crlj:Wistar (WI). Founder rats were crossed with F344/NSlc, and this strain was maintained by crossing with F344/NSlc (F2 or F3 generation, November 2017). At the point of sperm cryopreservation, this strain is not "congenic" strain (backcross generation was <5 generations), but background is mix of Crlj:Wistar and F344/NSlc. National BioResource Project for the Rat in Japan | 38676453 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2020-09-17) | 38676453 | 2026-08-29 11:49:56 | 0 | |||||
|
SS-Prr5em1Mcwi Resource Report Resource Website |
RRID:RGD_14398463 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Prr5 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp deletion in the exon 1 of the gene. Contact MCW rat distribution at [email protected] | 14398463 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2019-04-19) | 14398463 | 2026-08-29 11:49:56 | 0 | |||||
|
F344-Phf24em2Kyo Resource Report Resource Website |
RRID:RGD_38676450 | Rattus norvegicus | In 2013, F344/Stm female rat deleted 392b (delta392) of KIAA1045 (Phf24) was generated by Platinum TALEN methods. Although spontaneous GTCS is not observed, seizure susceptibility is increased and kindling induced by PTZ is promoted. In addition, locomotor activity is increased, disturbed behavior and spacial memory are decreased, and emotional behavior is increased due to unpleasant stimulation. National BioResource Project for the Rat in Japan | 38676450 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Sperm (as of 2021-07-01) | 38676450 | 2026-08-29 11:49:56 | 0 | |||||
|
SD-Tg(Prnp-LacZ/EGFP)12084 Resource Report Resource Website |
RRID:RGD_15045605 | Rattus norvegicus | This transgenic strain line 12084 carries the dual-reporter LacZ/EGFP (enhanced green fluorescent protein) cloned into the rat Prnp vector (raPrnp) and the expression of transgenes were driven by rat Prnp promoter. | 15045605 | transgenic | Rat Genome Database (RGD) | RGD | Unknown | 15045605 | 2026-08-29 11:49:56 | 0 | |||||
|
SD-Tg(Prnp-Prnp)2919 Resource Report Resource Website |
RRID:RGD_15045607 | Rattus norvegicus | This transgenic strain line Tg2919 carries the open reading frame of rat Prnp (prion protein) cloned into the rat Prnp vector (raPrnp) and the expression of transgene were driven by rat Prnp promoter. | 15045607 | transgenic | Rat Genome Database (RGD) | RGD | Unknown | 15045607 | 2026-08-29 11:49:56 | 0 | |||||
|
F344-Tg(Cx3cr1-cre/ERT2)3Ottc Resource Report Resource Website |
RRID:RGD_38508891 | Rattus norvegicus | The transgene of LE-Tg(Cx3cr1-cre)3Ottc (RGD: 13441557) was crossed onto Fischer344 background by backcrossing the hybrid to Fischer344 and select for the presence of transgene. The donor LE transgenic was generated by microinjection of LE embyos with a BAC DNA containing the Cx3cr1-cre/ERT2 transgene which is composed of cre/ERT2 recombinase gene driven by the rat genomic Cx3cr1promoter. | 38508891 | transgenic | Rat Genome Database (RGD) | RGD | Unknown | 38508891 | 2026-08-29 11:49:57 | 0 | |||||
|
RCCHan:WIST Resource Report Resource Website 1+ mentions |
RRID:RGD_149735906 | Rattus norvegicus | Wistar Hannover rats are derived from the Han:WIST strain from the Zentral Institut fur Versuchstierzucht (ZfV) (Hannover, Germany). In 1989, 156 pairs were introduced from ZfV to the Institute for Biomedical Research (IBM) in Switzerland (IBM underwent a structural change [name change] to BRL Ltd. and RCC Ltd.) | 149735906 | outbred | Rat Genome Database (RGD) | RGD | Unknown | 149735906 | 2026-08-29 11:49:56 | 4 | |||||
|
WI-Prdm14em10Nips Resource Report Resource Website |
RRID:RGD_41457452 | Rattus norvegicus | Prdm14 mutation was induced by introducing ribonucleic complexes (crRNA, tract RNA and Cas9 protein) into Crlj:WI rat embryos using electroporator. The resulting mutation is a 4412-bp deletion in exon 1 to 4. Homozygous Prdm14 knocked-out rats have the germ cell-deficient phenotype. Section of Mammalian Transgenesis, Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN | 41457452 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-02-24) | 41457452 | 2026-08-29 11:49:57 | 0 | |||||
|
SD-Lrp5em1Vari Resource Report Resource Website |
RRID:RGD_41404646 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a 18-bp deletion of exon 2 in the rat Lrp5 gene of Crl:SD embryos. | 41404646 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 41404646 | 2026-08-29 11:49:57 | 0 | |||||
|
F344.LE-ROSA26 em1(LTR-nLuc)Ottc Resource Report Resource Website |
RRID:RGD_38508893 | Rattus norvegicus | The mutated ROSA26 locus of LE-(ROSA)26 em1(LTR-nLuc)Ottc (RGD:13208223) was crossed onto Fischer344 background by backcrossing the hybrid to Fischer344 and select for the presence of mutated locus. The LE donor is CRISPR/Case9 knock-in strain that has cre recombinase-dependent expression of nanoluciferase under the control of HIV LTR promoter inserted to the rat ROSA26 locus. | 38508893 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 38508893 | 2026-08-29 11:49:56 | 0 | |||||
|
Iar:WIC Resource Report Resource Website |
RRID:RGD_125097496 | Rattus norvegicus | Institute for Animal Reproduction in Japan | 125097496 | outbred | Rat Genome Database (RGD) | RGD | Unknown | 125097496 | 2026-08-29 11:49:56 | 0 | |||||
|
WIC-Sparcem1Kykn Resource Report Resource Website |
RRID:RGD_39128166 | Rattus norvegicus | By CRISPR/Cas9 system, mutation was introduced in Sparc gene of Wistar-Imamichi rat. 7 bp deletion around Exon7. National BioResource Project for the Rat in Japan | 39128166 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2020-09-23) | 39128166 | 2026-08-29 11:49:56 | 0 | |||||
|
WIC-Cspg4em2Kyst Resource Report Resource Website |
RRID:RGD_39128162 | Rattus norvegicus | By CRISPR/Cas9 system, mutation was introduced in Cspg4 gene of Wistar-Imamichi rat. 7 bp deletion on Exon1. National BioResource Project for the Rat in Japan | 39128162 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2020-09-23) | 39128162 | 2026-08-29 11:49:56 | 0 | |||||
|
F344-Il2rgem1IexasRag2em1Iexas Resource Report Resource Website 1+ mentions |
RRID:RGD_38599190 | Rattus norvegicus | This strain was established by targeting Il2rg gene and Rag2 gene in F344/Jcl using CRISPR/Cas9 system. gRNA seq to Il2rg: CCAACCTCACTATGCACTATAGG (PAM: first CCA); gRNA to Rag2: AACATAGCCTTAATTCAACCAGG (PAM: last AGG); Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was performed by electroporation.This strain shows severe combined immunodeficiency (SCID) caused by 5-bp deletion in Il2rg gene on X chromosome and 1-bp insertion in Rag2 gene on chromosome 3. This strain grows normally under SPF condition. The sexual maturation is a bit late. National BioResource Project for the Rat in Japan | 38599190 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo (as of 2020-09-14) | 38599190 | 2026-08-29 11:49:56 | 1 | |||||
|
SD-Htr7em1Msu Resource Report Resource Website |
RRID:RGD_14696715 | Rattus norvegicus | CRISPR/Cas9 system was used to generate this mutant; this induced an 11 bp deletion in exon 1 and a 4 bp deletion in exon 2 of the Htr7 gene. | 14696715 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 14696715 | 2026-08-29 11:49:56 | 0 | |||||
|
SS-Vwfem3Mcwi-/- Resource Report Resource Website |
RRID:RGD_18182946 | Rattus norvegicus | CRISPR/Cas9 mediated gene editing was used to delete a 130,921bp region of the VWF gene in DahlSS/Mcw (SS/JrHsdMcwi ) rat embryos Contact MCW rat distribution at [email protected] | 18182946 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2020-01-14) | 18182946 | 2026-08-29 11:49:56 | 0 | |||||
|
LEW-Tg(HLA-B*2705m1,B2M)133-1TrgTg/0 Resource Report Resource Website |
RRID:RGD_35668858 | Rattus norvegicus | This strain was made by pronuclear injection into Lewis embryos. The embryos were co-injected with DNA fragments containing the HLA-B*2705 human gene (human HLA-B27 gene with Serine replacing Cys67) and the human beta-2-microglobulin gene. The strain carries 12 copies of HLA-B*2705 and 4 copies of the human beta-2-microglobulin gene. | 35668858 | transgenic | Rat Genome Database (RGD) | RGD | Unknown | 35668858 | 2026-08-29 11:49:56 | 0 | |||||
|
W-Gnrh1tm1(cre)Aeh Resource Report Resource Website |
RRID:RGD_35668859 | Rattus norvegicus | This model was generated using zinc finger nuclease (ZFN) method. Cre recombinase was expressed under the control of the endogenous Gnrh1 gene by inserting an internal ribosomal entry site (IRES)-Cre cassette 30bp downstream from the translational stop site of the Gnrh1 open reading frame. This was achieved by pronuclear co-injection of zinc finger nucleases (ATCCACAACATCCGAGTGtgacattGACGCTGAGATCCATGAC; cleavage site in lower case) along with a donor plasmid containing two 800bp homologous arms (HA) flanking IRES-Cre into a one-cell stage rat embryo. (1.) Allan Herbison at Department of Physiology, Development and Neuroscience, University of Cambridge, Cambridge, UK.; (2.) Vincent Prevot in INSERM, Lille, France. | 35668859 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2020-07-09) | 35668859 | 2026-08-29 11:49:56 | 0 | |||||
|
F344 -Aspaem34Kyo Hcn1em1Kyo Resource Report Resource Website |
RRID:RGD_150429634 | Rattus norvegicus | F344-Aspaem34Kyo (RGD:11564349) and F344-Hcn1em1Kyo (RGD:38676253) rats from the National BioResource Project-Rat were intercrossed to produce F1 hybrids and then to obtain F2 progeny. Rats homozygous for both Aspa and Hcn1 knockout alleles were selected from among F2 progeny and were used to generate the F344-Aspaem34Kyo/Hcn1em1Kyo double- knockout strain. | 150429634 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 150429634 | 2026-08-29 11:49:56 | 0 | |||||
|
SS-Tg(CAG-loxP-stop-loxP-Rpl10a-GFP)1Mcwi Resource Report Resource Website 1+ mentions |
RRID:RGD_14394520 | Rattus norvegicus | The Sleeping Beauty transposon system was used to introduce a Rpl10a-GFP fusion driven by a ubiquitous promoter, interupted by a floxed stop cassette Contact MCW rat distribution at [email protected] | 14394520 | transgenic | Rat Genome Database (RGD) | RGD | Unknown | 14394520 | 2026-08-29 11:49:57 | 1 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
