Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=39457947
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 39457947
Notes: The frogleg phenotype arose in a breeding colony of Sprague-Dawley rats which had originated with animals purchased from Taconic Farms (Hamilton, NY). The frogleg rats, which require no special husbandry, were bred and maintained at Spring Valley Laboratories, Inc (Woodbine,MD). The complex phenotype seen in the frogleg rat arises from a missense mutation (p.G369E) in the gene Bckdk.
Proper citation: RRID:RGD_39457947 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38599147
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 38599147
Notes: The BN homozygous Aire mutant rats were derived from founder rats that were backcrossed in a Sprague Dawley (SD; outbred strain) background for six generations to obtain AIRE-deficient SD rats. The original founder were from BN mutants carrying the mutations created by ZFN reagents targeting to a DNA sequence 59-TGCCACCCAGACCCCCCACAAAGAGAAGAGCCCTGGAAGAG-
39 in exon 3 of the Aire gene. This mutant carriesa 17-bp deletion in the nuclear
localization signal sequence, causing a premature stop codon.
Proper citation: RRID:RGD_38599147 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38548914
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 38548914
Notes: The Rag1, Rag2 double-knock rats were obtained by injecting the mixture of Rag1- and Rag2-targeting sgRNA into 1-cell embryo. The resulted mutations were a 1564-bp deletion in Rag1 and 85-bp deletion in Rag2.
Proper citation: RRID:RGD_38548914 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38548916
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 38548916
Notes: The Rag1, Rag2, and Il2rg triple-knockout rats were obtained by intercrossing Rag1 and Rag2 double-knockout rat (RGD:38548914) with Il2rg knockout rat (RGD:38548915).
Proper citation: RRID:RGD_38548916 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=25330091
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 25330091
Notes: CRISPR/Cas9 system was used to introduce a 11-bp deletion in exon 19 of rat Rictor gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_25330091 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=25394526
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 25394526
Notes: The rat strain was produced by injecting CRISPR/Cas9 targeting rat Dyrk1a into Crl:LE embryos. The result is a 5-bp deletion in exon 3 of the gene. Autism Rat Model Resource. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_25394526 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150429707
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 150429707
Notes: CRISPR/Cas9 system containing two pairs of single guide RNA
(sgRNA) primers: sgRNA1 (forward primer: 59-GCTACTG-
TAACTGACATGTT-39; reverse primer: 59-AACATGTCAGTTACAGTAGC-
39) and sgRNA2 (forward primer: 59-TCAAGGGTAAACTCAGACTG-39;
reverse primer: 59-CAGTCTGAGTTTACCCTTGA-39), was injected to Sprague-Dawley rat one-cell embryos. The F0 pups were screened by genomic DNA sequencing to identify heterozygous CYP2C11+/2 founders.This mutant strain carries a two base pairs (GT)
insertion into exon 6 of CYP2C11 and resulting in the knockout allele.
Proper citation: RRID:RGD_150429707 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=14394494
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2019-03-22)
Alternate IDs: 14394494
Notes: CRISPR/Cas9 system was used to introduce a 28-bp deletion mutation in exon 1 of the Kcnj2 gene of SS/JrHsdMcwi rat embryos. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_14394494 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=41412170
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 41412170
Notes: This strain was given to Medical College of Wisconsin by Ake Lernmark and maintained there.
Proper citation: RRID:RGD_41412170 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=25314294
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 25314294
Notes: Fromter selected from outbred Munich-Wistar rats for large numbers of superficial glomeruli.
Proper citation: RRID:RGD_25314294 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=41404660
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 41404660
Notes: The Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. The GK line was established by repeated inbreeding from Wistar rats selected at the upper limit of normal distribution for glucose tolerance. Repeated selection of rats with tendency to lowest glucose tolerance resulted in clear-cut glucose intolerance after five generations.Until the end of 1980s,
Proper citation: RRID:RGD_41404660 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=14985210
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 14985210
Notes: The bioinformatics software (Horizon Discovery, St. Louis, USA) was used to design a short guide RNA (sgRNA) targeting a Protospacer Adjacent Motif (PAM) sequence within exon 7 of the rat Cyfip1gene (GGCAGATCCACAATCCATCCagg) on chromosome 1 (first 21 of 32 exons, Refseq: NC_005100.4, NM_001107517.1).sgRNA-Cas9 was performed by nucleofecting the sgRNA-Cas9 into rat C6 glial cells. Genomic DNA (gDNA) PCR products were subsequently generated from nucleofected C6 cells using primers flanking the sgRNA site (FOR: GCCAAAGCTTCCCCTAAAGT; REV: TGGGCGTCAAGTACATTCTG; 497bp amplicon). Embryos were collected from donor female Long Evans rats and injected with the validated sgRNA-Cas9. Then implanted into synchronized pseudopregnant Long Evans recipient female This mutant carries 4bp out of frame heterozygous deletion in exon 7 of the Cyfip1, resulting bioinformatics prediction of an early stop codon in exon 8.
Proper citation: RRID:RGD_14985210 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=41404661
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 41404661
Notes: Inbred Wistar rats maintained at Center for Neurosciences and Cell Biology of Coimbra, University of Coimbra, Coimbra, Portugal
Proper citation: RRID:RGD_41404661 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=126925139
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 126925139
Notes: To specifically knockout Dnmt1 in the myocardium, Cre-loxP system was used by crossing alpha -MHC-Cre rats with Dnmt1 cKO rats. Dnmt1+/- offspring positive for the alpha MHC-Cre transgene (double-positive) were selected. In the second round of crossbreeding, the double-positive rats were crossed with Dnmt1 cKO rats, and Dnmt1-/- offspring positive for the alpha MHC-Cre transgene were obtained as myocardium-specific Dnmt1-KO rats
Proper citation: RRID:RGD_126925139 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=35668861
Source Database: Rat Genome Database (RGD)
Genetic Background: transgenic
Availability: Unknown
Alternate IDs: 35668861
Notes: This strain was made by pronuclear injection into LEW/Crl embryos. The embryos were co-injected with DNA fragments containing the HLA-B*2705 human gene and the human beta-2-microglobulin gene. The strain carries 20 copies of HLA-B*2705 and 15 copies of the human beta-2-microglobulin gene.
Proper citation: RRID:RGD_35668861 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150429760
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 150429760
Notes: A congenic strain made by introducing IgH haplotype block (a segment of chr6:146,030,387 to 154,214,590 ,Rn5 assembly of the rat genome). from SHR-B2 (SHR/Utx) into SHR-A3 (SHRSP/BbbUtx). The igH block contains sequences that are highly divergent between of SHR-A3 and SHR-B2 .
Proper citation: RRID:RGD_150429760 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=149735570
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2021-07-23)
Alternate IDs: 149735570
Notes: CRISPR-Cas9-mediated knock-in of a single base pair polymorphism of guanine to alanine in exon 10, resulting in a threonine to alanine substitution at amino acid position 299 in the rat. Mimics the same nucleotide substitution for the threonine to alanine substitution at amino acid position 300 in humans (T300A), Homozygosity for this allele is embryonic lethal. RRRC
Proper citation: RRID:RGD_149735570 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=41404651
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 41404651
Notes: CRISPR/Cas9 system was used to introduce an
inversion coupled with small deletions in the exon 2 at both the sgRNA1 (11 bp) and sgRNA2 sites (3 bp) in the rat Lrp5 gene of Crl:SD embryos.
Proper citation: RRID:RGD_41404651 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=41408339
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 41408339
Notes: The Sprague-Dawley transposon mutagenesis spermatogonial gene trap library was screen to generate rats with a disrupted Pclo gene in Wistar rat background. The transposon element was integrated into exon 3 of the Pclo genomic sequence, leading to a premature stop in the reading frame.
Proper citation: RRID:RGD_41408339 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38676452
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2020-09-17)
Alternate IDs: 38676452
Notes: This strain was establishe by CRISPR-Cas9 system at Osaka University. Target sequence is CCATGGGGGTGTTGATGTCCAAG (CCA is PAM sequence). Back ground strain is Crlj:Wistar (WI). This strain is line No. 24 and has a 141-bp deletion in Phf24 gene. Off-target effects (214 candidate region) have not yet been examined. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_38676452 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
