Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13210773
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Cryopreserved Sperm (as of 2017-09-07)
Alternate IDs: 13210773
Notes: This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.
Proper citation: RRID:RGD_13210773 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13208571
Source Database: Rat Genome Database (RGD)
Genetic Background: transgenic
Availability: Live Animals (as of 2019-04-26)
Alternate IDs: 13208571
Notes: Transgenic overexpressing tamoxifen inducible cre/ERT2 under the control of the Cyp11b2 promoter Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_13208571 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13208576
Source Database: Rat Genome Database (RGD)
Genetic Background: transgenic
Availability: Live Animals (as of 2017-08-14)
Alternate IDs: 13208576
Notes: Transgenic overexpressing tamoxifen inducible cre/ERT2 under the control of the Slc12a1 (Sglt2) promoter Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_13208576 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12910127
Source Database: Rat Genome Database (RGD)
Genetic Background: transgenic
Availability: Unknown
Alternate IDs: 12910127
Notes: This transgenic strain carries a synthetic 108-nucleotide DNA fragment spanning the 5 prime extracellular region of GHS-R was cloned in the antisense orientation driven by tyrosine hydroxylase (Th) promoter.
Proper citation: RRID:RGD_12910127 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13207529
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 13207529
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Spp1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in Exon 3 of the Spp1 gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_13207529 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13506738
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 13506738
Notes: The Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. The GK line was established by repeated inbreeding from Wistar rats selected at the upper limit of normal distribution for glucose tolerance. Repeated selection of rats with tendency to lowest glucose tolerance resulted in clear-cut glucose intolerance after five generation.In 1988, GK/Par substrain was established in Paris, France by initiating breeding pairs F35 from Japanese colonies .
Proper citation: RRID:RGD_13506738 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12902621
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2017-06-20)
Alternate IDs: 12902621
Notes: This ZFN model contains a monoallelic deletion of the Bdnf gene, encoding for the nerve growth factor protein BDNF. Homozygous animals carrying the Bdnf deletion are postnatal lethal. Reductions of BDNF have been observed in patients with Alzheimer's disease (AD), and this model may be useful for understanding the role of BDNF in AD. Horizon Discovery
Proper citation: RRID:RGD_12902621 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12902625
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2017-05-09)
Alternate IDs: 12902625
Notes: This ZFN model contains a 20-bp deletion within the Nr1i2 gene. No induction of Cyp3a1 in the model. Horizon Discovery
Proper citation: RRID:RGD_12902625 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12902616
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2017-05-09)
Alternate IDs: 12902616
Notes: These rats were created using CrISPR/Cas9 system to replace the Rat ApoE gene with the Human 4 allele APOE gene Horizon Discovery
Proper citation: RRID:RGD_12902616 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13673907
Source Database: Rat Genome Database (RGD)
Genetic Background: outbred
Availability: Unknown
Alternate IDs: 13673907
Notes: These HS rats were derived from NMcwi:HS, used to be maintained by Dr. Solberg Woods at Medical College of Wisconsin and now are maintained at Wake Forest Baptist Medical Center by Dr. Solberg Woods's Laboratory starting in 2017.
Proper citation: RRID:RGD_13673907 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11565132
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Cryopreserved Sperm (as of 2016-11-21)
Alternate IDs: 11565132
Notes: A congenic strain made by introducing a segments of chromosome 1 from SHR/Izm into SHRSP/Izm National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan.
Proper citation: RRID:RGD_11565132 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13432200
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 13432200
Notes: Congenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X sister mating was carried out to generate sub-strains containing smaller congenic intervals.
Proper citation: RRID:RGD_13432200 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13207513
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryorecovery (as of 2017-08-03)
Alternate IDs: 13207513
Notes: This is compound transgenic/mutant rat strain derived from the breeding of SS-Tg(Slc12a1-Ncf2-2A-Luc) and SS-Ncf2em1Mcwi. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_13207513 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13432202
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 13432202
Notes: Congenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X sister mating was carried out to generate sub-strains containing smaller congenic intervals.
Proper citation: RRID:RGD_13432202 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13208842
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 13208842
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Ptgs2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 53-bp deletion of exon 4 in the Ptgs2 gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_13208842 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13437612
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 13437612
Notes: This strain was produced by injecting ZFNs target sequence CCGCGGTTGCTTTGCGCTCTGGGTGCTGTTGCTGGCGCA into Dahl S rat eggs as . The resulting mutation is a 17-bp deletion of the sequence gctctgggtgctgttgc in exon 1.
Proper citation: RRID:RGD_13437612 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13432204
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 13432204
Notes: Congenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X sister mating was carried out to generate sub-strains containing smaller congenic intervals.
Proper citation: RRID:RGD_13432204 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13207595
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 13207595
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Tph1 gene of WKY/NCrl rat embryos. The resulting mutation is a 1-bp deletion in the exon 4 of the Tph1 gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_13207595 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13207518
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryorecovery (as of 2018-05-01)
Alternate IDs: 13207518
Notes: CRISPR/SpCas9 was used to create indel mutations in Hspa1a, Hspa1b, Hspa1L in SHR/NCrl embryos. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_13207518 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13207514
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2017-08-03)
Alternate IDs: 13207514
Notes: CRISPR/SpCas9 was used to knock in the Epac-SH187, Epac-based FRET sensor into the Rosa26 locus under the control of the endogenous promoter using an Ad2 splice acceptor. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_13207514 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
