Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
GK/Ox Resource Report Resource Website 1+ mentions |
RRID:RGD_4889464 | Rattus norvegicus | Original breeders are from a colony in Paris (CNRS URA 307, Paris, France) which were obtained in 1995 and since then bred locally in Oxford, UK | 4889464 | inbred | Rat Genome Database (RGD) | RGD | Unknown | 4889464 | 2026-08-15 12:07:00 | 3 | |||||
|
WLI/EerRrrc Resource Report Resource Website |
RRID:RGD_4891107 | Rattus norvegicus | 3 pairs of WKY males and females with lowest immobility and highest climbing scores in the forced swim test were mated. Dept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinois. Rat Resource and Research Center | 4891107 | inbred | Rat Genome Database (RGD) | RGD | Unknown | 4891107 | 2026-08-15 12:06:59 | 0 | |||||
|
WMI/EerRrrc Resource Report Resource Website |
RRID:RGD_4891103 | Rattus norvegicus | 3 pairs of WKY males and females with highest immobility and lowest climbing scores in the forced swim test were mated. Dept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinois. Rat Resource and Research Center | 4891103 | inbred | Rat Genome Database (RGD) | RGD | Unknown | 4891103 | 2026-08-15 12:06:59 | 0 | |||||
|
SS-Renem1Mcwi Resource Report Resource Website |
RRID:RGD_4139880 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence acccttcatgctggccaagtttgacggggttctgggcatg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 5. | 4139880 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Sperm (as of 2017-01-26) | 4139880 | 2026-08-15 12:06:59 | 0 | |||||
|
BN.GK-(D2Wox49-D2Rat70)/Ox Resource Report Resource Website |
RRID:RGD_4143458 | Rattus norvegicus | This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. | 4143458 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 4143458 | 2026-08-15 12:06:59 | 0 | |||||
|
BN.GK-(D2Rat40-D2Wox35)/Ox Resource Report Resource Website |
RRID:RGD_4143457 | Rattus norvegicus | This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. | 4143457 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 4143457 | 2026-08-15 12:06:59 | 0 | |||||
|
BN.GK-(D2Wox30-D2Wox68)/Ox Resource Report Resource Website |
RRID:RGD_4143456 | Rattus norvegicus | This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. | 4143456 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 4143456 | 2026-08-15 12:06:59 | 0 | |||||
|
SS-Nox4em2Mcwi Resource Report Resource Website |
RRID:RGD_4139883 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence ggttacagcttctacctatgcaataaggtaagggtc into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 7. | 4139883 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Sperm (as of 2017-01-26) | 4139883 | 2026-08-15 12:06:59 | 0 | |||||
|
SS-Sh2b3em1Mcwi Resource Report Resource Website |
RRID:RGD_4139885 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is an in-frame 6-bp deletion in exon 2. | 4139885 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 4139885 | 2026-08-15 12:06:59 | 0 | |||||
|
BHD/Dspe Resource Report Resource Website |
RRID:RGD_4139889 | Rattus norvegicus | A rat showing hereditary renal cell carcinoma was found in a Jcl:SD rat colony and named Nihon rat. In this rat strain mutation was identified as an insertion of a cytosine (C) in a C tract within exon 3 of Flcn . This germline mutation results in a frameshift and produces a stop codon 26 amino-acids downstream. Thereafter they have been maintained at Dainippon Sumitomo Pharma Co., Ltd. National BioResource Project for the Rat in Japan | 4139889 | inbred | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo (as of 2018-06-06) | 4139889 | 2026-08-15 12:06:59 | 0 | |||||
|
SS.BN-(D6Rat149-D6Rat18)/Mcwi Resource Report Resource Website |
RRID:RGD_4145089 | Rattus norvegicus | SS/JrHsdMcwi were crossed with SS-6BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain | 4145089 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 4145089 | 2026-08-15 12:07:00 | 0 | |||||
|
ALD/Hyo Resource Report Resource Website |
RRID:RGD_4139892 | Rattus norvegicus | In a colony of Donryu rats, Yoshida found a male rat showing hepatomegaly and splenomegaly in 1981. These mutant rats were transferred to Kagoshima University and maintained in heterozygous condition so far. National BioResource Project for the Rat in Japan | 4139892 | inbred | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo | 4139892 | 2026-08-15 12:06:59 | 0 | |||||
|
ODS-Gulood/od/ShiJcl Resource Report Resource Website |
RRID:RGD_4140404 | Rattus norvegicus | Dr. Susumu Makino and his colleagues found several animals that had gait abnormalities among Wistar rats maintained at Shionogi Co. They named these animals osteogenic disorder (OD) rats because they exhibited prominent bone and joint abnormalities and systemic bleeding. Subsequent studies revealed that these symptoms were derived from an ascorbic acid (vitamin C) deficiency arising from defective gulonolactone oxidase (GLO) activity. This characteristic was confirmed to be the result of a mutation involving the autosomal single recessive gene od. Scurvy due to L-gulonolactone oxidase deficincy; phenotype normalizes if supplied with ascorbic acid 300mg/kg/d. od/od rats are more susceptible to dental caries as compared with +/+ rats, in only amoun parous females. CLEA Japan, Inc | 4140404 | inbred | Rat Genome Database (RGD) | RGD | Live Animals (as of 2021-04-29) | 4140404 | 2026-08-15 12:06:59 | 0 | |||||
|
COP-Chr 16DA/McoRrrc Resource Report Resource Website |
RRID:RGD_4140409 | Rattus norvegicus | Transfer of the DA-rat chromosome 16 (RNO16) into the COP-rat background | 4140409 | consomic | Rat Genome Database (RGD) | RGD | Unknown | 4140409 | 2026-08-15 12:06:59 | 0 | |||||
|
LEXF8C/Stm Resource Report Resource Website |
RRID:RGD_4140408 | Rattus norvegicus | The LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985. National BioResource Project for the Rat in Japan | 4140408 | recombinant_inbred | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo | 4140408 | 2026-08-15 12:06:59 | 0 | |||||
|
Wig/Ymas Resource Report Resource Website |
RRID:RGD_4891165 | Rattus norvegicus | These are congenic wiggling rats established by transferring the wiggling gene from Long-Evans Cinnamon (LEC) to Wistar King-Aptekman/Hokkaido (WKAH) strain | 4891165 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 4891165 | 2026-08-15 12:06:59 | 0 | |||||
|
SHR.WKY-(D4Rat10-D4Rat15)/IzmTkyo Resource Report Resource Website |
RRID:RGD_4142540 | Rattus norvegicus | This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. National BioResource Project for the Rat in Japan | 4142540 | congenic | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm | 4142540 | 2026-08-15 12:06:59 | 0 | |||||
|
SD-Pax6Sey/Mce Resource Report Resource Website |
RRID:RGD_2325754 | Rattus norvegicus | Autosomal dominant mutation that arose spontaneously in SD rats. Genomic DNA analysis from mutants revealed a single base(G) insertion in the exon generating a novel 5' donor splice site. This led to the internal a 602-bp deletion of Pax6 mRNA. | 2325754 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 2325754 | 2026-08-15 12:07:00 | 0 | |||||
|
ACI.FHH-(D1Mit18-D1Rat90)(D14Rat98-D14Hmgc18)/Mcwi Resource Report Resource Website |
RRID:RGD_4145374 | Rattus norvegicus | Congenic strain developed by crossing ACI.FHH-(D1Rat74-D1Rat90)/Eur (Rf-1a) males to ACI.FHH-(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/EurMcwi (Rf-1a+4) double congenic females | 4145374 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 4145374 | 2026-08-15 12:07:00 | 0 | |||||
|
SHR.WKY-(D3Rat108-D3Rat166)/IzmTkyo Resource Report Resource Website |
RRID:RGD_4142545 | Rattus norvegicus | This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. National BioResource Project for the Rat in Japan | 4142545 | congenic | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm | 4142545 | 2026-08-15 12:06:59 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
