Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00063065
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00009286(zipt-1)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00009286(zipt-1)
Availability: unknown
Source References: EMPTY
Synonyms: zipt-1(ve967[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I.
Notes: Homozygous viable. Deletion of 1175 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATACACAGGTCTATGGCGAGCTGGAACCC ; Right flanking sequence: GAGAATATGGCTCCGCGCCCATTCTCCTTT. zipt-1 crRNA A: TTCTTGTACTTTCTCATCCC; zipt-1 crRNA B: TCGTTCATCTCGTGCATCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00063065 Copy
http://www.wormbase.org/db/get?name=WBStrain00063066
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: C34H4.5(ve968[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV.
Notes: Homozygous viable. Deletion of 1781 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAAGCTAATGGGTTTCTGGATGATTAGCC ; Right flanking sequence: CGGGCGATCTTGATGAAGGTCAACTTTCGA. C34H4.5 sgRNA A: GTGAACAATATGCAAAGCTC; C34H4.5 sgRNA B: aaaaGCGAAATTTATCGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00063066 Copy
http://www.wormbase.org/db/get?name=WBStrain00063060
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: pfk-1.1(ve961[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X.
Notes: Homozygous viable. Deletion of 4271 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TAAATACTATTGTCATAAATTACAGAATTT ; Right flanking sequence: CGACCGTTGAAAGTTCTGCAATTTTGGAAT. pfk-1.1 crRNA A: TGCATAATTCGAAATGGACG; pfk-1.1 crRNA B: AACGATGACGAGCGAGAACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00063060 Copy
http://www.wormbase.org/db/get?name=WBStrain00063052
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00021942(madf-1)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00021942(madf-1)
Availability: unknown
Source References: EMPTY
Synonyms: madf-1(ve953[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV.
Notes: Homozygous viable. Deletion of 1324 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATTGACAATTGTCTCTTCAAGGCTATTCGA ; Right flanking sequence: TGGATTTAGATTATTTTCAACTTTTTCGGT. madf-1 sgRNA A: ATCGGCTTCTTTTAATTCGG; madf-1 sgRNA B: GAAATTAAATTTTAATCCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00063052 Copy
http://www.wormbase.org/db/get?name=WBStrain00063050
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: F26D11.1(ve950[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
Notes: Homozygous viable. Deletion of 440 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATGTAGAGAAAATGAAAGCCGGCACACCA ; Right flanking sequence: CGTCACTGTTGATGCGAATAGTGAAAATGT. F26D11.1 sgRNA A: AGTCTATCAGAATCATTCAG; F26D11.1 sgRNA B: ATATTTGATTCATCGGGACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00063050 Copy
http://www.wormbase.org/db/get?name=WBStrain00063056
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: F37A8.5(ve957[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III.
Notes: Homozygous viable. Deletion of 852 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACACAGTATAATATAATCTATTTTCCACCC ; Right flanking sequence: AGGGGAAATTTATTATCGAGCTGGCACATA. F37A8.5 crRNA A: AAAGGAGAAGCACAAGGAGG; F37A8.5 crRNA B: ATCGAGTCAAAAGTATAAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00063056 Copy
http://www.wormbase.org/db/get?name=WBStrain00063057
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: C16D9.6(ve958[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
Notes: Homozygous viable. Deletion of 1372 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGAATTTGACCCAATCAATGCCAGCTTTT ; Right flanking sequence: TGGCTCTAGGTGAATTATTTCTAGTCAGGA. C16D9.6 sgRNA A: GTTTGATGGAATGTATCCGA; C16D9.6 sgRNA B: ACATACAAACCTGTCATACG. Please referencAu et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00063057 Copy
http://www.wormbase.org/db/get?name=WBStrain00063054
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00003154(mcm-2)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006787(unc-52)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00003154(mcm-2), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006787(unc-52), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: mcm-2(ve955[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II.
Notes: Made_by: RG KO Group|"umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Late larval lethal. Deletion of 5085 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 animals that become increasingly unc and eventually die (ve955 homozygotes) and paralysed dpyunc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: TTGACATTCTCAATTCTCAATTGCTGAGCC; Right flanking sequence: CGCGATGGAGCGCGATTGCGCGGGCATGAC. mcm-2 sgRNA A: TTTTCGATGAATTCCGACTC; mcm-2 sgRNA B: ACAGAATTCAAAAGAGGCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."
Proper citation: RRID:WB-STRAIN:WBStrain00063054 Copy
http://www.wormbase.org/db/get?name=WBStrain00063059
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: B0281.8(ve960[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Notes: Homozygous viable. Deletion of 1112 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CAGTCATATTTTTTTGCTTCTCTATCGCCT ; Right flanking sequence: TCGCAGATTTCGCATTTTGGCACTTGCATT. B0281.8 sgRNA A: GAGACATGTTAAAGATATTG; B0281.8 sgRNA B: TGATGACTTCTCAAGTGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00063059 Copy
http://www.wormbase.org/db/get?name=WBStrain00063041
Source Database: WormBase (WB)
Affected Genes: WBGene00000204(arx-6)|WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00000204(arx-6), WBGene00001078(dpy-19), WBGene00001609(glp-1), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: arx-6(ve941[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III.
Notes: Made_by: RG KO Group|"qIs26 [lag-2::GFP + rol-6(su1006)] III. Sterile. Deletion of 651 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) grotty adults with vulval blip (ve941 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: GCGTCACACGCTCCAGGCAGCTCTCTGTCT; Right flanking sequence: GAATTTTTGAAGCGTTTCAATTAAttttct. arx-6 sgRNA A: TGAGCAATTCAGTTCGCAGG; arx-6 sgRNA B: TTCAGCAGAAACACGGGCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."
Proper citation: RRID:WB-STRAIN:WBStrain00063041 Copy
http://www.wormbase.org/db/get?name=WBStrain00063042
Source Database: WormBase (WB)
Affected Genes: WBGene00000634(col-58)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00000634(col-58), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: col-58(ve942[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I.
Notes: Homozygous viable. Deletion of 643 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acattacaccgtaattacactttatcacct ; Right flanking sequence: AGGTGATGACATATCAGTGCTTCGTCACGA. col-58 sgRNA A: aaaggaaggatgggttggtg; col-58 sgRNA B: GGAGTTCCGGGATCATCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00063042 Copy
http://www.wormbase.org/db/get?name=WBStrain00063043
Source Database: WormBase (WB)
Affected Genes: WBGene00000232(avr-14)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00000232(avr-14), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: avr-14(ve943[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I.
Notes: Homozygous viable. Prone to rupture at vulva, can be maintained as a homozygous population. Deletion of 5798 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATAGGTAATCGTTTAACACTACGATATGCT ; Right flanking sequence: agggctttttcttttttctctctttatcct. avr-14 sgRNA A: GATAAATCTAATCGAAGTGG; avr-14 sgRNA B: aagggacaggggacgaaggg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00063043 Copy
http://www.wormbase.org/db/get?name=WBStrain00063044
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00013541(lonp-2)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00013541(lonp-2)
Availability: unknown
Source References: EMPTY
Synonyms: lonp-2(ve944[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III.
Notes: Homozygous viable. Deletion of 5206 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTACTGCCAGGCGCAAGCCTTAAAATACCT ; Right flanking sequence: TGGGCCATCTGCTGGAACAGGATTAGCGTG. lonp-2 sgRNA A: CACTTTAATTTCGACCTGAT; lonp-2 sgRNA B: TCTTTATTCACCGCACCTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00063044 Copy
http://www.wormbase.org/db/get?name=WBStrain00063049
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: K03B8.6(ve949[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
Notes: Homozygous viable. Deletion of 1958 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATGTGTGTTGGCCGTGTGTATGAAAGAGG ; Right flanking sequence: AAAAACgttttacgtgtatttttgttttat. K03B8.6 sgRNA A: CGTGGTTTGAGTCTGTCTGG; K03B8.6 sgRNA B: AAGAAAAGGCGGTGAAGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00063049 Copy
http://www.wormbase.org/db/get?name=WBStrain00063039
Source Database: WormBase (WB)
Affected Genes: WBGene00000942(deb-1)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00000942(deb-1), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: deb-1(ve939[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V.
Notes: Made_by: RG KO Group|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Maintain by picking wild-type GFP+ mKate2+. Deletion of 7456 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead embryos (ve939 homozygotes; embryonic lethal), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Left flanking Sequence: CCATCAGAATGGCCATTCTCTTCGCAGCCG; Right flanking sequence: ttgtaagatttgtacagatttttcgagctt. deb-1 sgRNA A: ACAGGAGAACGATATTGTGG; deb-1 sgRNA B: accatccataagtctcaagg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."
Proper citation: RRID:WB-STRAIN:WBStrain00063039 Copy
http://www.wormbase.org/db/get?name=WBStrain00063085
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: ZK1240.5(ve998[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Notes: Homozygous viable. Deletion of 1535 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GGCGCTGATATTTTGAAGCGCACAAAAACC ; Right flanking sequence: GCAAAATGGGCATACAATTCTGCCGTTGTT. ZK1240.5 sgRNA A: GAATGTGCACATAGAAAGTC; ZK1240.5 sgRNA B: CGCGAACCAACTGAGATACC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00063085 Copy
http://www.wormbase.org/db/get?name=WBStrain00063084
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: ZK1010.10(ve997[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III.
Notes: Homozygous viable. Deletion of 2442 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATCTAGATTCCACTATAGTTATCCTGGAAA ; Right flanking sequence: GATCTCGACCACTTGGTGCATCGAGTCGTC. ZK1010.10 sgRNA A: CCTAGGAATTCATGACATTg; ZK1010.10 sgRNA B: GTAGAGATGGTAGGATCCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00063084 Copy
http://www.wormbase.org/db/get?name=WBStrain00063087
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00045255(nhr-146)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00045255(nhr-146)
Availability: unknown
Source References: EMPTY
Synonyms: nhr-146(ve1000[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV.
Notes: Homozygous viable. Deletion of 3445 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGATCGATTTGCTGTTTGACTTTTTTCCG ; Right flanking sequence: AGGCGTACGCTGTGGATGAGAAATTCTATG. nhr-146 sgRNA A: CATTTTAAAAGTGCAACGGC; nhr-146 sgRNA B: TGAGCTGAGCCATGTGATGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00063087 Copy
http://www.wormbase.org/db/get?name=WBStrain00063088
Source Database: WormBase (WB)
Affected Genes: WBGene00001063(dpy-1)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00015648(orai-1)
Genomic Alteration: WBGene00001063(dpy-1), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00015648(orai-1)
Availability: unknown
Source References: EMPTY
Synonyms: orai-1(ve1007[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC1(s2023) [dpy-1(s2170) umnIs41] III.
Notes: Made_by: RG KO Group|"umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Homozygous sterile. Deletion of 7387 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile GFP+ non-mKate2 (ve1007 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. orai-1 is near unc-45 and therefore near the outer limit of the sC1 balancer. Left flanking Sequence: ATCCTGACGTCAGAGATCTTCTGAAATCCG; Right flanking sequence: GTGTTCCGTCATGCCATTTTAATCTGTGTG. orai-1 crRNA A: CTTTCGAAGTCTCCGTTTCG; orai-1 crRNA B: GTGGCGAGACAGTGAGCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."
Proper citation: RRID:WB-STRAIN:WBStrain00063088 Copy
http://www.wormbase.org/db/get?name=WBStrain00063294
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00000254(bli-4), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: E01A2.1(hd7099[loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III.
Notes: Made_by: VH KO group|"umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7099 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VH7099 and CGC92. hd7099 is a 1508 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."
Proper citation: RRID:WB-STRAIN:WBStrain00063294 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
