Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 46 showing 901 ~ 920 out of 4,651 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:RGD_8142385

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=8142385

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 8142385
Notes: Animals transferred from Professor T. Suzuki, Kinki University School of Medicine, Kinki, Japan in 2002, descended from the original SHR sub-strains reported by Okamoto, 1974

Proper citation: RRID:RGD_8142385 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7240514

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 7240514
Notes: Congenic substrain derived by marker-assisted transfer of the desired region from DA.PVG.1AV1-(D4Kiru90-D4Kiru111)/Kiru onto the genetic background of DA/ZtmKini

Proper citation: RRID:RGD_7240514 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7240513

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 7240513
Notes: congenic strain derived by marker-assisted transfer of the desired region from PVG.1AV1/Kini onto the genetic background of DA/ZtmKini

Proper citation: RRID:RGD_7240513 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7240512

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 7240512
Notes: congenic strain derived by marker-assisted transfer of the desired region from PVG.1AV1/Kini onto the genetic background of DA/ZtmKini

Proper citation: RRID:RGD_7240512 Copy   


  • RRID:RGD_7241049

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7241049

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2024-11-26)
Alternate IDs: 7241049
Notes: ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offspring which were intercrossed and offspring maintained as homozygous. This allele was made by ZFN mutagenesis. The resulting mutation is a 26-bp frameshift deletion in exon 4 (ACTACTACCCAGAAGGCCTGGGCCAC). inotiv

Proper citation: RRID:RGD_7241049 Copy   


  • RRID:RGD_7241048

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7241048

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 7241048
Notes: This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 9-bp deletion with 1-bp insertion in exon 5 Sigma Advanced Genetic Engineering Labs

Proper citation: RRID:RGD_7241048 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7241047

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo (as of 2017-06-06)
Alternate IDs: 7241047
Notes: This strain was produced by crossing LE-Lrrk1em1Sage with LE-Lrrk2em1Sage Horizon Discovery

Proper citation: RRID:RGD_7241047 Copy   


  • RRID:RGD_8661233

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=8661233

Source Database: Rat Genome Database (RGD)
Genetic Background: transgenic
Availability: Unknown
Alternate IDs: 8661233
Notes: This strain was made by pronuclear microinjection of SS/JrHsdMcwi embryos with a Sleeping Beauty transposon vector harboring a ubiquitous CAG promoter driving enhanced green fluorescent protein along with mRNA encoding the SB100X transposase. The transposon inserted into rat chromosome 15 near 35.6 Mb (rn4)

Proper citation: RRID:RGD_8661233 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=8551748

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 8551748
Notes: A double congenic strain derived from the progenitor strain SS.LEW-(D3Rat17-D3Mco80)/Ayd and SS.LEW-(D10Rat194-D10Chm243)/Ayd

Proper citation: RRID:RGD_8551748 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=8661235

Source Database: Rat Genome Database (RGD)
Genetic Background: transgenic
Availability: Unknown
Alternate IDs: 8661235
Notes: This strain was made by pronuclear microinjection of a Sleeping Beauty transposon vector harboring a ubiquitous CAG promoter driving the Brown Norway allele cDNA for Rab38 along with mRNA encoding the SB100X transposase. The transposon inserted into rat chromosome 14 near 13.2 Mb (rn4)

Proper citation: RRID:RGD_8661235 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=8551752

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 8551752
Notes: A triple congenic strain derived from the progenitor strain SS.LEW-(D1Rat320-D1Mgh32)/Ayd and SS.LEW-(D10Rat194-D10Chm243)(D10Chm10-D10Rat11)/Ayd

Proper citation: RRID:RGD_8551752 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=8552285

Source Database: Rat Genome Database (RGD)
Genetic Background: transgenic
Availability: Cryopreserved Sperm
Alternate IDs: 8552285
Notes: The original work using this transgenic rat was published in Science (Yamazaki et al. 2000). This transgenic rat was generated in the Wistar outbred strain (Charles River, Japan). We maintained the L1 line. The transgenic rat was generated using a DNA construct in which the mouse Period1 promoter drives firefly luciferase National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_8552285 Copy   


  • RRID:RGD_7411634

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7411634

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 7411634
Notes: Crlj:WI females were bred to DA/Slc males to generate F1 pups which were bred by brother-sister mating; only black (non-agouti) pups were picked for breeding. (The genotype of the pups was checked by backcrossing to BN (for BB or Bb) and Hooded strains (for HH or Hh) genotype.) When the aaBBCCHH genotype of F2 was confirmed then the strain was maintained by brother-sister mating. Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN

Proper citation: RRID:RGD_7411634 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7777143

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 7777143
Notes: SS.LEW-(D5Mco34-D5Rat108)/Jr was selectively backcrossed with the SS/Jr strain

Proper citation: RRID:RGD_7777143 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=8551759

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 8551759
Notes: A double congenic strain derived from the progenitor strain SS.MNS-(D2Chm90-D2Rat38)/Ayd and SS.LEW-(D10Chm10-D10Rat11)/Ayd

Proper citation: RRID:RGD_8551759 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=8551763

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 8551763
Notes: A double congenic strain derived from the progenitor strain SS.MNS-(D2Rat155-D2Chm419)/Ayd and SS.LEW-(D10Rat194-D10Chm243)/Ayd

Proper citation: RRID:RGD_8551763 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6907094

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 6907094
Notes: A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm.

Proper citation: RRID:RGD_6907094 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6907096

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 6907096
Notes: A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm.

Proper citation: RRID:RGD_6907096 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7421612

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 7421612
Notes: A segment of chromosome 16 was transferred from LEW/Crlc into the SS/Jr background, the F2 rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.

Proper citation: RRID:RGD_7421612 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=8551880

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 8551880
Notes: Congenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.

Proper citation: RRID:RGD_8551880 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X