Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
LCR/2Tol Resource Report Resource Website |
RRID:RGD_10402167 | Rattus norvegicus | LCR/Tol (LCR/Mco) bred till the twenty-sixth generation | 10402167 | inbred | Rat Genome Database (RGD) | RGD | Unknown | 10402167 | 2026-08-29 11:49:48 | 0 | |||||
|
HCR/1Tol Resource Report Resource Website |
RRID:RGD_10402160 | Rattus norvegicus | HCR/Mco bred till the fifth generation | 10402160 | inbred | Rat Genome Database (RGD) | RGD | Unknown | 10402160 | 2026-08-29 11:49:48 | 0 | |||||
|
SHR/HktIzm Resource Report Resource Website |
RRID:RGD_10043813 | Rattus norvegicus | SHR/Kyushu rat (Kyushu University) was delivered to Shimane University in 2000 and maintained as inbred. National BioResource Project for the Rat in Japan | 10043813 | inbred | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo; Cryopreserved Sperm | 10043813 | 2026-08-29 11:49:48 | 0 | |||||
|
SS.BN-(D13Got42-D13Rat61)/Mcwi Resource Report Resource Website |
RRID:RGD_12792939 | Rattus norvegicus | SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain | 12792939 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 12792939 | 2026-08-29 11:49:49 | 0 | |||||
|
HCR/2Tol Resource Report Resource Website |
RRID:RGD_10402163 | Rattus norvegicus | HCR/Mco bred till the twenty-sixth generation | 10402163 | inbred | Rat Genome Database (RGD) | RGD | Unknown | 10402163 | 2026-08-29 11:49:48 | 0 | |||||
|
SD-Abcc6em2Qlju-/- Resource Report Resource Website |
RRID:RGD_10413852 | Rattus norvegicus | This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 23 bp-deletion (TGCGCAGGCCTGAGGGTGAGTCC) from the first coding exon of the rat Abcc6 gene. The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining. | 10413852 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 10413852 | 2026-08-29 11:49:48 | 0 | |||||
|
LEW.SS-(D7Rat27-D7Mgh1)(D17Rat15-D17Rat51)(D10Mgh6-D10Mgh1)/Ayd Resource Report Resource Website |
RRID:RGD_10402852 | Rattus norvegicus | multiple congenic strain was generated by combining the three separate congenic strains | 10402852 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 10402852 | 2026-08-29 11:49:48 | 0 | |||||
|
SS.BN-(2340-RN34_13048990782)/Mcwi Resource Report Resource Website |
RRID:RGD_12802367 | Rattus norvegicus | SS/JrHsdMcwi were crossed with SS-13BN(D13Rat123-D13Rat101)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain | 12802367 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 12802367 | 2026-08-29 11:49:49 | 0 | |||||
|
WIC-Dmdem2Kykn Resource Report Resource Website |
RRID:RGD_11040980 | Rattus norvegicus | By CRISPR/Cas9 system, mutation was introduced in dystrophin (Dmd) gene of Wistar-Imamichi rat: deletion of exon3 to exon16 National BioResource Project for the Rat in Japan | 11040980 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo (as of 2017-05-02) | 11040980 | 2026-08-29 11:49:49 | 0 | |||||
|
SS.BN-(D13Hmgc64-4582)/Mcwi Resource Report Resource Website |
RRID:RGD_12802366 | Rattus norvegicus | SS/JrHsdMcwi were crossed with SS-13BN(D13Rat123-D13Rat101)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain | 12802366 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 12802366 | 2026-08-29 11:49:49 | 0 | |||||
|
SS.BN-(D13Hmgc64-D13Hmgc23)/Mcwi Resource Report Resource Website |
RRID:RGD_12802365 | Rattus norvegicus | SS/JrHsdMcwi were crossed with SS-13BN(D13Rat123-D13Rat101)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain | 12802365 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 12802365 | 2026-08-29 11:49:49 | 0 | |||||
|
SD-Bsnem1Ionsz Resource Report Resource Website |
RRID:RGD_10450489 | Rattus norvegicus | CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2a-NpHR-EYFP-2a-ChR2-mcherry-ires-WGA-cre behind the last exon of Bsn Institute of Neuroscience, Chinese Academy of Sciences | 10450489 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 10450489 | 2026-08-29 11:49:48 | 0 | |||||
|
TRM.W-Tg(RNB1-186G14)51Kyo Resource Report Resource Website |
RRID:RGD_11040581 | Rattus norvegicus | F344/Stm rat BAC clone RNB1-186G14 was microinjected into embryos of Wistar rats. The founder rats were backcrossed to TRM/Kyo rats. BAC vector:pKS145. RNB1-186G14 contains region between 60185236-60354841 of Rat Chr 10 and this region contains Spata22 gene expressed in testes. National BioResource Project for the Rat in Japan | 11040581 | transgenic | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm | 11040581 | 2026-08-29 11:49:48 | 0 | |||||
|
LEW.SS-(D7Rat27-D7Mgh1)(D17Rat15-D17Rat51)/Ayd Resource Report Resource Website |
RRID:RGD_10402850 | Rattus norvegicus | double congenic strain was generated by combining the two separate congenic strains | 10402850 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 10402850 | 2026-08-29 11:49:48 | 0 | |||||
|
SD-Abcc6em5Qlju-/- Resource Report Resource Website |
RRID:RGD_10413858 | Rattus norvegicus | This strain was made by ZFN mutagenesis. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 11-bp deletion from cDNA position 39-49 (CTGCGCAGGCC). The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining. | 10413858 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 10413858 | 2026-08-29 11:49:48 | 0 | |||||
|
SS.BN-(D13Rat25-rs198199323)/Mcwi Resource Report Resource Website |
RRID:RGD_12802364 | Rattus norvegicus | SS/JrHsdMcwi were crossed with SS-13BN(D13Rat123-D13Rat101)/Mcwi (RGD:2293145), rats from F1 were intercrossed and genotyped to get the congenic strain | 12802364 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 12802364 | 2026-08-29 11:49:49 | 0 | |||||
|
WIC-Tg(Nanog-YFP*)1Utr Resource Report Resource Website 1+ mentions |
RRID:RGD_11040987 | Rattus norvegicus | BAC (containing rat Nanog gene) vector was injected into Iar:Wistar-Imamichi rats. The construct is as follows: Venus-IRES-puromycin resistance gene. National BioResource Project for the Rat in Japan | 11040987 | transgenic | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-04-21) | 11040987 | 2026-08-29 11:49:49 | 1 | |||||
|
DA-Tph2em3Mcwi Resource Report Resource Website |
RRID:RGD_10402822 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 7. | 10402822 | mutant | Rat Genome Database (RGD) | RGD | Cryorecovery (as of 2017-01-26) | 10402822 | 2026-08-29 11:49:48 | 0 | |||||
|
WTC.Cg-dmyTg(Mrs2-EGFP)131Kyo Resource Report Resource Website |
RRID:RGD_11040936 | Rattus norvegicus | CHORI230-9K13 recombinant BAC (Mrs2/EGFP) was introduced into Crlj:Wistar embyos. BAC Tg rats were backcrossed with WTC.DMY-dmy. dmy gene: homozygous, transgene: hemizygous. 4 lines: #15, #39, #92, #131 National BioResource Project for the Rat in Japan | 11040936 | transgenic | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm | 11040936 | 2026-08-29 11:49:48 | 0 | |||||
|
CV/Iet Resource Report Resource Website |
RRID:RGD_11041108 | Rattus norvegicus | The Laboratory of Reproductive Toxicology at the Institute of Environmental Toxicology has been maintaining a Wistar derived PD strain of rats. In 1986, 1 female and 2 males exhibiting very short and sparse vibrissae were found in a litter of 7 parented by a pd/pd female and phenotypically normal pd/+ male. In 2008, a male Wistar rat and F56 female were crossed, and obtained heterozygous rats were sib-mated. After that, sib mating between homozygous rats was started. National BioResource Project for the Rat in Japan | 11041108 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm | 11041108 | 2026-08-29 11:49:48 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
