Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Species:caenorhabditis elegans (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

62,713 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
RB1810
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032501 Caenorhabditis elegans cpr-5(ok2344) V. Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"W07B8.5. Homozygous. Outer Left Sequence: AATCGAGTCTGCGGTTTCAG. Outer Right Sequence: CAACGTTCTCTCGCATCAAA. Inner Left Sequence: GGTTTTTCACCTCGAATGGA. Inner Right Sequence: TTGTGACACCCCGAAATTCT. Inner Primer PCR Length: 3132 bp. Deletion Size: 2015 bp. Deletion left flank: TTGTTTGTTCCGTCCATTCTACACTGAGTC. Deletion right flank: TTATCAGTTAATTTTATCAGTATCTTTTTT." WBGene00000785(cpr-5) WBGene00000785(cpr-5) WB-STRAIN:WBStrain00032501 WormBase (WB) WB available WB-STRAIN:RB1810, CGC_RB1810 2026-08-15 09:31:57 0
RB1809
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00032500 Caenorhabditis elegans ins-30(ok2343) I. Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZC334.2. Homozygous. Outer Left Sequence: CCATCTGACGTTGCTCAGAA. Outer Right Sequence: GGAGCATGAGCACAACTCAA. Inner Left Sequence: AGGCTCGTAGATGCCAAAAA. Inner Right Sequence: TGATCTACCTCTGCATCCCC. Inner Primer PCR Length: 2309 bp. Deletion Size: 1078 bp. Deletion left flank: TTTTAGAAGACAATTATCAGTTGAAAAATC. Deletion right flank: TTTATCAACAAACTCCTTCCGCAAGTCTTC." WBGene00002113(ins-30) WBGene00002113(ins-30) WB-STRAIN:WBStrain00032500 WormBase (WB) WB available WB-STRAIN:RB1809, CGC_RB1809 2026-08-15 09:31:57 1
RB1742
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032433 Caenorhabditis elegans ifb-1(ok2227) II. F10C1.2. Homozygous. Outer Left Sequence: AATTAGCTTCCCCGCAATTT. Outer Right Sequence: GTTGTTGATGCCTCCTTGGT. Inner Left Sequence: CTTTAGTTGACTCCGCCCAC. Inner Right Sequence: GCAAATGCGAGAAACCCTTA. Inner Primer PCR Length: 2999 bp. Deletion Size: 2379 bp. Deletion left flank: CAATTTCTAAGTAAGTAGTGTCTTGATCTC. Deletion right flank: AGCTTTTTGGTTTTGAAATGTTGAAAATTT. Insertion Sequence: ATTTCTAAGTAAGTAGTGTCTTGATCTC.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00002053(ifb-1) WBGene00002053(ifb-1) WB-STRAIN:WBStrain00032433 WormBase (WB) WB available WB-STRAIN:RB1742, CGC_RB1742 2026-08-15 09:31:56 0
RB1741
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032432 Caenorhabditis elegans C39F7.2(ok2226) V. C39F7.2. Homozygous. Outer Left Sequence: CTGAGCCTAAACCGAACCAA. Outer Right Sequence: ATAGATTGTGTGGTGGGGGA. Inner Left Sequence: AAGCCTAAGCCAAAGCCTTC. Inner Right Sequence: GATCCAGGTTAGGTGTCGGA. Inner Primer PCR Length: 3282 bp. Deletion Size: 2315 bp. Deletion left flank: TAGCGTCAGTAGCGAGCTCACGCTCGCCAC. Deletion right flank: CTGTTCCCGCTACAAAAAGTTTCTTTTACA.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00016539(madd-2) WBGene00016539(madd-2) WB-STRAIN:WBStrain00032432 WormBase (WB) WB available WB-STRAIN:RB1741, CGC_RB1741 2026-08-15 09:31:56 0
RB1738
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032430 Caenorhabditis elegans C36B7.5(ok2223) X. C36B7.5. Homozygous. Outer Left Sequence: GTTGGAGGTTTGAGATTCCG. Outer Right Sequence: CTTGATAAATGCCCACCGTT. Inner Left Sequence: GGAAAAGTTCGCTTACCGTG. Inner Right Sequence: CGAAACTTCACAGAGACGCA. Inner Primer PCR Length: 3111 bp. Deletion Size: 958 bp. Deletion left flank: CATGAGTTGCCACAACCAGTCCATGACATC. Deletion right flank: TGTCCGCGATGGATAATAGTTGGATGGATT.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00016468(C36B7.5) WBGene00016468(C36B7.5) WB-STRAIN:WBStrain00032430 WormBase (WB) WB available WB-STRAIN:RB1738, CGC_RB1738 2026-08-15 09:31:56 0
RB1748
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032439 Caenorhabditis elegans eat-4&ZK512.7(ok2233) III. Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK512.6, ZK512.7. Homozygous. Outer Left Sequence: ACAAATGGTTGGAGAGCCAC. Outer Right Sequence: ATGCAGCTTCTCCTCCAAAA. Inner Left Sequence: AGCCCAACACAACAAAAAGG. Inner Right Sequence: GGATCTTGTTGGATCGGAGA. Inner Primer PCR Length: 3386 bp. Deletion Size: 1329 bp. Deletion left flank: TACAGCACTCTTTTTTCAGGGAGTTTGTTA. Deletion right flank: GTGCTAAAATGCCTGAATATCGTAGTAAAA." WBGene00001135(eat-4)|WBGene00013986(ZK512.7) WBGene00001135(eat-4), WBGene00013986(ZK512.7) WB-STRAIN:WBStrain00032439 WormBase (WB) WB available WB-STRAIN:RB1748, CGC_RB1748 2026-08-15 09:31:56 0
RB1747
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032438 Caenorhabditis elegans R10E11.3(ok2232) III. Made_by: OMRF Knockout Group|"R10E11.3. Homozygous. Outer Left Sequence: GGCGGCAATTTGAACTTTTA. Outer Right Sequence: CGTTTCAGAAGAGTCTCGGG. Inner Left Sequence: GAGAAGGTGCTAATGCGCTC. Inner Right Sequence: TTGGATCATCAGCAGCGTAG. Inner Primer PCR Length: 2429 bp. Deletion Size: 1440 bp. Deletion left flank: TTGGAAATACATGTTACTGCAACTCAGTGA. Deletion right flank: CGCAGCATAATAATGATCAAATTTTCAGAG."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00011216(usp-46) WBGene00011216(usp-46) WB-STRAIN:WBStrain00032438 WormBase (WB) WB available WB-STRAIN:RB1747, CGC_RB1747 2026-08-15 09:31:56 0
RB1744
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032435 Caenorhabditis elegans Y67A10A.8(ok2229) IV. Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y67A10A.8. Homozygous. Outer Left Sequence: GTTCCCAACAGCTGGATCTC. Outer Right Sequence: GGCGATGACCAAGAAAATGT. Inner Left Sequence: CTAGAATTCCCCGACTTCCC. Inner Right Sequence: AATTCACGAGCCGATTTTTG. Inner Primer PCR Length: 3333 bp. Deletion Size: 1522 bp. Deletion left flank: AATTGGAATTGACTGAAGAAGAAGAGATTT. Deletion right flank: CACTAAAATGTTTACAATTTTTGTGTTTCT. Insertion Sequence: T." WBGene00013457(paqr-3) WBGene00013457(paqr-3) WB-STRAIN:WBStrain00032435 WormBase (WB) WB available WB-STRAIN:RB1744, CGC_RB1744 2026-08-15 09:31:56 0
RB1749
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032440 Caenorhabditis elegans numr-1(ok2239); snt-2(tm1711) F08F8.5. Homozygous. Outer Left Sequence: CACAAAGAGCATGCCTTGAA. Outer Right Sequence: GGTCTGAAATCTGGAGAGCG. Inner Left Sequence: GACAAAATGCGGAACGTCTT. Inner Right Sequence: GTTTGCAGATCCCAATTCGT. Inner Primer PCR Length: 2296 bp. Deletion Size: 975 bp. Deletion left flank: CGTAAATGAAAACAAATTTTGATGGAGATT. Deletion right flank: CTGAGACATTGAAATCAAATTTCCTTTGTC.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00017270(numr-1) WBGene00017270(numr-1) WB-STRAIN:WBStrain00032440 WormBase (WB) WB available PMID:38443452 WB-STRAIN:RB1749, CGC_RB1749 2026-08-15 09:31:56 0
RB1807
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032498 Caenorhabditis elegans F55G11.2(ok2341) IV. F55G11.2. Homozygous. Outer Left Sequence: ATGGCATTTGTTAAGCCCTG. Outer Right Sequence: TAGCTTGTCGTTGTCGTTGC. Inner Left Sequence: TTTGTGTTGTTTGGCTCGTC. Inner Right Sequence: CTTGCGGTCCAAAAGACATT. Inner Primer PCR Length: 2122 bp. Deletion Size: 1155 bp. Deletion left flank: ACTAGCTTCCAAGTTGACTATATTAATATT. Deletion right flank: ACTGTAATTCACAAATTTTAGATAAGTTAA. Insertion Sequence: TTGACTATATTAAT.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00010123(F55G11.2) WBGene00010123(F55G11.2) WB-STRAIN:WBStrain00032498 WormBase (WB) WB available WB-STRAIN:RB1807, CGC_RB1807 2026-08-15 09:31:57 0
RB1806
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032497 Caenorhabditis elegans fbxb-8(ok2340) I. F49B2.1. Homozygous. Outer Left Sequence: TCGATTCGAATGGTTGTTCA. Outer Right Sequence: ACGTCATATGTGGCGCATTA. Inner Left Sequence: ACATAGGACACCCCTTGTCG. Inner Right Sequence: CCCGCATTTTTGTAGATCGT. Inner Primer PCR Length: 2880 bp. Deletion Size: 1799 bp. Deletion left flank: AGCTTCGATCACGATTCAGAGCAGTTTTGT. Deletion right flank: TCAATCCCGGCAATTTGCCGATTTACTGAA.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00009861(fbxb-8) WBGene00009861(fbxb-8) WB-STRAIN:WBStrain00032497 WormBase (WB) WB available WB-STRAIN:RB1806, CGC_RB1806 2026-08-15 09:31:57 0
RB1804
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032495 Caenorhabditis elegans T22D1.11(ok2338) IV. Made_by: OMRF Knockout Group|"T22D1.11 Homozygous. Outer Left Sequence: ttggggatgttcaattggtt. Outer Right Sequence: aacgactcaaaagctcagcc. Inner Left Sequence: atattggcagacacgcgatt. Inner Right Sequence: gccagagagctgctcaaaat. Inner Primer PCR Length: 2803. Deletion size: about 1600 bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00020688(cest-6) WBGene00020688(cest-6) WB-STRAIN:WBStrain00032495 WormBase (WB) WB available WB-STRAIN:RB1804, CGC_RB1804 2026-08-15 09:31:57 0
RB1802
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032493 Caenorhabditis elegans F54E4.4(ok2336) X. F54E4.4. Homozygous. Outer Left Sequence: CGATTGGGCCCTATTTAACA. Outer Right Sequence: TACAGCTGCCAGATGGATCA. Inner Left Sequence: TCATGTCTTATGGTGAAATTTTGG. Inner Right Sequence: AAGGAGTGAAGTGTGCAGAATG. Inner Primer PCR Length: 3144 bp. Deletion Size: 1217 bp. Deletion left flank: ACTCACTGTAGTAGTAGTTGTGGGTAAAGT. Deletion right flank: ATAAATGCGGGAAAAGCGGACGATCTTCTG.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00010060(F54E4.4) WBGene00010060(F54E4.4) WB-STRAIN:WBStrain00032493 WormBase (WB) WB available WB-STRAIN:RB1802, CGC_RB1802 2026-08-15 09:31:57 0
RB1727
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032419 Caenorhabditis elegans F44C8.7(ok2206) V. F44C8.7. Homozygous. Outer Left Sequence: CGGGATCTTGAAAATCTGGA. Outer Right Sequence: CGTCGCATTTGATGTTGAAT. Inner Left Sequence: TGAGCACATTTTGGGCCTAT. Inner Right Sequence: CTATCGCCCGGTAACACAGT. Inner Primer PCR Length: 2869 bp. Deletion Size: 1098 bp. Deletion left flank: TCTGAAAATTTAATTTTCAGTGCAAAATGA. Deletion right flank: TTACATGAGAAAATTCACGAAAAAGTTACA.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00018414(nstp-8) WBGene00018414(nstp-8) WB-STRAIN:WBStrain00032419 WormBase (WB) WB available WB-STRAIN:RB1727, CGC_RB1727 2026-08-15 09:31:55 0
RB1726
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032418 Caenorhabditis elegans tab-1&F31E8.5(ok2198) II. F31E8.3, F31E8.5. Homozygous. Outer Left Sequence: GCACAAGTTGTTGGGGAAGT. Outer Right Sequence: TTTTTGTCTGGGGTTGGAAG. Inner Left Sequence: TCTTTCACGGGACCTTCATC. Inner Right Sequence: ATCGGAGAACACAAGTTGCC. Inner Primer PCR Length: 2481 bp. Deletion Size: 1702 bp. Deletion left flank: TAAAATATGTAAATTTGATCATCAAAAATT. Deletion right flank: TCAATCCTCCAACGGATTCACATGTCTTCT.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00006380(tab-1)|WBGene00017955(F31E8.5) WBGene00006380(tab-1), WBGene00017955(F31E8.5) WB-STRAIN:WBStrain00032418 WormBase (WB) WB available WB-STRAIN:RB1726, CGC_RB1726 2026-08-15 09:31:55 0
RB1724
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032416 Caenorhabditis elegans F42G4.6(ok2196) II. F42G4.6. Homozygous. Outer Left Sequence: CTGCCTACCTATCTGCCTGC. Outer Right Sequence: AAGAAGGCTCCTCGCATACA. Inner Left Sequence: AACAGGTTCATTTTGCGGTC. Inner Right Sequence: GAAATGGAAGAATTTGCCGA. Inner Primer PCR Length: 2746 bp. Deletion Size: 1759 bp. Deletion left flank: TGTTTCAAGCACAACGGTCAGTGTACCTAC. Deletion right flank: CCAAAAATTTTATTCAGAATTGTAATAATT. Insertion Sequence: CAACGGTCAGTGTACCTA.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00009643(F42G4.6) WBGene00009643(F42G4.6) WB-STRAIN:WBStrain00032416 WormBase (WB) WB available WB-STRAIN:RB1724, CGC_RB1724 2026-08-15 09:31:55 0
RB1723
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032415 Caenorhabditis elegans C27H2.2(ok2191) IV. C27H2.2. Homozygous. Outer Left Sequence: TTCCGAATTGTTTGGCTTTC. Outer Right Sequence: TTTACAATCGCGTGTTGCTC. Inner Left Sequence: CAATTTCACCCTTCGATGCT. Inner Right Sequence: TTTGCCATTGTGCCAATAAA. Inner Primer PCR Length: 2901 bp. Deletion Size: 703 bp. Deletion left flank: ACTTTTTTCCGAATTTCGAATATTGTAAAA. Deletion right flank: GGCACCCTTCCGGCTCCGTCGAGCAAGAAA.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WB-STRAIN:WBStrain00032415 WormBase (WB) WB available WB-STRAIN:RB1723, CGC_RB1723 2026-08-15 09:31:55 0
RB1720
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032412 Caenorhabditis elegans Y106G6A.1(ok2178) I. Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y10G6A.1. Homozygous. Outer Left Sequence: GGCATCTTCCCATTCGAGTA. Outer Right Sequence: GAGTCATCGGTTACCGTCGT. Inner Left Sequence: CCTGTGCTCAACTCTGCTTG. Inner Right Sequence: TAAATTCGAATGGCGGTCTC. Inner Primer PCR Length: 2210 bp. Deletion Size: 1007 bp. Deletion left flank: GTTTTAAATATTATTTTTACCGTAAAATTC. Deletion right flank: AAGTTTGTTCAATGTTTTGAAAACCGTAGC." WBGene00013694(mekk-3) WBGene00013694(mekk-3) WB-STRAIN:WBStrain00032412 WormBase (WB) WB available WB-STRAIN:RB1720, CGC_RB1720 2026-08-15 09:31:55 0
RB1728
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032420 Caenorhabditis elegans tra-3(ok2207) IV. LLC1.1. Homozygous. Outer Left Sequence: TTGAGCACAACCTGAAGCAG. Outer Right Sequence: AAAACTCCTATTTGCCCGCT. Inner Left Sequence: TCACAGTTTTCGGGTTTTCC. Inner Right Sequence: AGATGTTTCCGGTGGAGTTG. Inner Primer PCR Length: 3226 bp. Deletion Size: 1474 bp. Deletion left flank: AAAGAACTGAAGTTATGTTTATTGGTTAAT. Deletion right flank: TCTCATTTTGAACTAGAAACTATTGCTAAC. Insertion Sequence: CTTCAGAAAAATATTACAAATTGTATCTTTTTACACAAGATTTTAAATTTTTAAAAATA AAATCTGAAACAATTTTGTCTAATAAAAACAAAGGCCCTCATGAATTGTTTATGAAAAT TATCACCCAAATAAGTTGATTAACTTGGGCGGGGCTTATTTTACAGGTTTTGA.|"LLC1.1. Homozygous. Outer Left Sequence: TTGAGCACAACCTGAAGCAG. Outer Right Sequence: AAAACTCCTATTTGCCCGCT. Inner Left Sequence: TCACAGTTTTCGGGTTTTCC. Inner Right Sequence: AGATGTTTCCGGTGGAGTTG. Inner Primer PCR Length: 3226 bp. Deletion Size: 1474 bp. Deletion left flank: AAAGAACTGAAGTTATGTTTATTGGTTAAT. Deletion right flank: TCTCATTTTGAACTAGAAACTATTGCTAAC. Insertion Sequence: CTTCAGAAAAATATTACAAATTGTATCTTTTTACACAAGATTTTAAATTTTTAAAAATAAAATCTGAAACAATTTTGTCTAATAAAAACAAAGGCCCTCATGAATTGTTTATGAAAATTATCACCCAAATAAGTTGATTAACTTGGGCGGGGCTTATTTTACAGGTTTTGA."|"Made_by: OMRF Knockout Group"|"Supplementary_genotype tra-3 (ok2207)"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00006606(tra-3) WBGene00006606(tra-3) WB-STRAIN:WBStrain00032420 WormBase (WB) WB available PMID:37628820 WB-STRAIN:RB1728, CGC_RB1728 2026-08-15 09:31:55 0
RB1733
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032425 Caenorhabditis elegans C10G11.6(ok2212) I. C10G11.6. Homozygous. Outer Left Sequence: GACGAAGACGACGAAGAAGG. Outer Right Sequence: GGGGTACCCGATGAGCTACT. Inner Left Sequence: TTTACCACGGAAAACCTTCG. Inner Right Sequence: TTTTGGTGATTCATCGGGTT. Inner Primer PCR Length: 3386 bp. Deletion Size: 1357 bp. Deletion left flank: TTCCGTCTCCGTTTGTTCGAAAAATTCCCG. Deletion right flank: TTCCTCCGCCAGGACTCGTTGGAATCAATG.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00015686(C10G11.6) WBGene00015686(C10G11.6) WB-STRAIN:WBStrain00032425 WormBase (WB) WB available WB-STRAIN:RB1733, CGC_RB1733 2026-08-15 09:31:55 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.