Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00032501
Source Database: WormBase (WB)
Affected Genes: WBGene00000785(cpr-5)
Genomic Alteration: WBGene00000785(cpr-5)
Availability: available
Source References: EMPTY
Synonyms: cpr-5(ok2344) V.
Alternate IDs: WB-STRAIN:RB1810, CGC_RB1810
Notes: Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"W07B8.5. Homozygous. Outer Left Sequence: AATCGAGTCTGCGGTTTCAG. Outer Right Sequence: CAACGTTCTCTCGCATCAAA. Inner Left Sequence: GGTTTTTCACCTCGAATGGA. Inner Right Sequence: TTGTGACACCCCGAAATTCT. Inner Primer PCR Length: 3132 bp. Deletion Size: 2015 bp. Deletion left flank: TTGTTTGTTCCGTCCATTCTACACTGAGTC. Deletion right flank: TTATCAGTTAATTTTATCAGTATCTTTTTT."
Proper citation: RRID:WB-STRAIN:WBStrain00032501 Copy
http://www.wormbase.org/db/get?name=WBStrain00032500
Source Database: WormBase (WB)
Affected Genes: WBGene00002113(ins-30)
Genomic Alteration: WBGene00002113(ins-30)
Availability: available
Source References: EMPTY
Synonyms: ins-30(ok2343) I.
Alternate IDs: WB-STRAIN:RB1809, CGC_RB1809
Notes: Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZC334.2. Homozygous. Outer Left Sequence: CCATCTGACGTTGCTCAGAA. Outer Right Sequence: GGAGCATGAGCACAACTCAA. Inner Left Sequence: AGGCTCGTAGATGCCAAAAA. Inner Right Sequence: TGATCTACCTCTGCATCCCC. Inner Primer PCR Length: 2309 bp. Deletion Size: 1078 bp. Deletion left flank: TTTTAGAAGACAATTATCAGTTGAAAAATC. Deletion right flank: TTTATCAACAAACTCCTTCCGCAAGTCTTC."
Proper citation: RRID:WB-STRAIN:WBStrain00032500 Copy
http://www.wormbase.org/db/get?name=WBStrain00032433
Source Database: WormBase (WB)
Affected Genes: WBGene00002053(ifb-1)
Genomic Alteration: WBGene00002053(ifb-1)
Availability: available
Source References: EMPTY
Synonyms: ifb-1(ok2227) II.
Alternate IDs: WB-STRAIN:RB1742, CGC_RB1742
Notes: F10C1.2. Homozygous. Outer Left Sequence: AATTAGCTTCCCCGCAATTT. Outer Right Sequence: GTTGTTGATGCCTCCTTGGT. Inner Left Sequence: CTTTAGTTGACTCCGCCCAC. Inner Right Sequence: GCAAATGCGAGAAACCCTTA. Inner Primer PCR Length: 2999 bp. Deletion Size: 2379 bp. Deletion left flank: CAATTTCTAAGTAAGTAGTGTCTTGATCTC. Deletion right flank: AGCTTTTTGGTTTTGAAATGTTGAAAATTT. Insertion Sequence: ATTTCTAAGTAAGTAGTGTCTTGATCTC.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032433 Copy
http://www.wormbase.org/db/get?name=WBStrain00032432
Source Database: WormBase (WB)
Affected Genes: WBGene00016539(madd-2)
Genomic Alteration: WBGene00016539(madd-2)
Availability: available
Source References: EMPTY
Synonyms: C39F7.2(ok2226) V.
Alternate IDs: WB-STRAIN:RB1741, CGC_RB1741
Notes: C39F7.2. Homozygous. Outer Left Sequence: CTGAGCCTAAACCGAACCAA. Outer Right Sequence: ATAGATTGTGTGGTGGGGGA. Inner Left Sequence: AAGCCTAAGCCAAAGCCTTC. Inner Right Sequence: GATCCAGGTTAGGTGTCGGA. Inner Primer PCR Length: 3282 bp. Deletion Size: 2315 bp. Deletion left flank: TAGCGTCAGTAGCGAGCTCACGCTCGCCAC. Deletion right flank: CTGTTCCCGCTACAAAAAGTTTCTTTTACA.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032432 Copy
http://www.wormbase.org/db/get?name=WBStrain00032430
Source Database: WormBase (WB)
Affected Genes: WBGene00016468(C36B7.5)
Genomic Alteration: WBGene00016468(C36B7.5)
Availability: available
Source References: EMPTY
Synonyms: C36B7.5(ok2223) X.
Alternate IDs: WB-STRAIN:RB1738, CGC_RB1738
Notes: C36B7.5. Homozygous. Outer Left Sequence: GTTGGAGGTTTGAGATTCCG. Outer Right Sequence: CTTGATAAATGCCCACCGTT. Inner Left Sequence: GGAAAAGTTCGCTTACCGTG. Inner Right Sequence: CGAAACTTCACAGAGACGCA. Inner Primer PCR Length: 3111 bp. Deletion Size: 958 bp. Deletion left flank: CATGAGTTGCCACAACCAGTCCATGACATC. Deletion right flank: TGTCCGCGATGGATAATAGTTGGATGGATT.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032430 Copy
http://www.wormbase.org/db/get?name=WBStrain00032439
Source Database: WormBase (WB)
Affected Genes: WBGene00001135(eat-4)|WBGene00013986(ZK512.7)
Genomic Alteration: WBGene00001135(eat-4), WBGene00013986(ZK512.7)
Availability: available
Source References: EMPTY
Synonyms: eat-4&ZK512.7(ok2233) III.
Alternate IDs: WB-STRAIN:RB1748, CGC_RB1748
Notes: Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK512.6, ZK512.7. Homozygous. Outer Left Sequence: ACAAATGGTTGGAGAGCCAC. Outer Right Sequence: ATGCAGCTTCTCCTCCAAAA. Inner Left Sequence: AGCCCAACACAACAAAAAGG. Inner Right Sequence: GGATCTTGTTGGATCGGAGA. Inner Primer PCR Length: 3386 bp. Deletion Size: 1329 bp. Deletion left flank: TACAGCACTCTTTTTTCAGGGAGTTTGTTA. Deletion right flank: GTGCTAAAATGCCTGAATATCGTAGTAAAA."
Proper citation: RRID:WB-STRAIN:WBStrain00032439 Copy
http://www.wormbase.org/db/get?name=WBStrain00032438
Source Database: WormBase (WB)
Affected Genes: WBGene00011216(usp-46)
Genomic Alteration: WBGene00011216(usp-46)
Availability: available
Source References: EMPTY
Synonyms: R10E11.3(ok2232) III.
Alternate IDs: WB-STRAIN:RB1747, CGC_RB1747
Notes: Made_by: OMRF Knockout Group|"R10E11.3. Homozygous. Outer Left Sequence: GGCGGCAATTTGAACTTTTA. Outer Right Sequence: CGTTTCAGAAGAGTCTCGGG. Inner Left Sequence: GAGAAGGTGCTAATGCGCTC. Inner Right Sequence: TTGGATCATCAGCAGCGTAG. Inner Primer PCR Length: 2429 bp. Deletion Size: 1440 bp. Deletion left flank: TTGGAAATACATGTTACTGCAACTCAGTGA. Deletion right flank: CGCAGCATAATAATGATCAAATTTTCAGAG."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032438 Copy
http://www.wormbase.org/db/get?name=WBStrain00032435
Source Database: WormBase (WB)
Affected Genes: WBGene00013457(paqr-3)
Genomic Alteration: WBGene00013457(paqr-3)
Availability: available
Source References: EMPTY
Synonyms: Y67A10A.8(ok2229) IV.
Alternate IDs: WB-STRAIN:RB1744, CGC_RB1744
Notes: Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y67A10A.8. Homozygous. Outer Left Sequence: GTTCCCAACAGCTGGATCTC. Outer Right Sequence: GGCGATGACCAAGAAAATGT. Inner Left Sequence: CTAGAATTCCCCGACTTCCC. Inner Right Sequence: AATTCACGAGCCGATTTTTG. Inner Primer PCR Length: 3333 bp. Deletion Size: 1522 bp. Deletion left flank: AATTGGAATTGACTGAAGAAGAAGAGATTT. Deletion right flank: CACTAAAATGTTTACAATTTTTGTGTTTCT. Insertion Sequence: T."
Proper citation: RRID:WB-STRAIN:WBStrain00032435 Copy
http://www.wormbase.org/db/get?name=WBStrain00032440
Source Database: WormBase (WB)
Affected Genes: WBGene00017270(numr-1)
Genomic Alteration: WBGene00017270(numr-1)
Availability: available
Source References: PMID:38443452
Synonyms: numr-1(ok2239); snt-2(tm1711)
Alternate IDs: WB-STRAIN:RB1749, CGC_RB1749
Notes: F08F8.5. Homozygous. Outer Left Sequence: CACAAAGAGCATGCCTTGAA. Outer Right Sequence: GGTCTGAAATCTGGAGAGCG. Inner Left Sequence: GACAAAATGCGGAACGTCTT. Inner Right Sequence: GTTTGCAGATCCCAATTCGT. Inner Primer PCR Length: 2296 bp. Deletion Size: 975 bp. Deletion left flank: CGTAAATGAAAACAAATTTTGATGGAGATT. Deletion right flank: CTGAGACATTGAAATCAAATTTCCTTTGTC.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032440 Copy
http://www.wormbase.org/db/get?name=WBStrain00032498
Source Database: WormBase (WB)
Affected Genes: WBGene00010123(F55G11.2)
Genomic Alteration: WBGene00010123(F55G11.2)
Availability: available
Source References: EMPTY
Synonyms: F55G11.2(ok2341) IV.
Alternate IDs: WB-STRAIN:RB1807, CGC_RB1807
Notes: F55G11.2. Homozygous. Outer Left Sequence: ATGGCATTTGTTAAGCCCTG. Outer Right Sequence: TAGCTTGTCGTTGTCGTTGC. Inner Left Sequence: TTTGTGTTGTTTGGCTCGTC. Inner Right Sequence: CTTGCGGTCCAAAAGACATT. Inner Primer PCR Length: 2122 bp. Deletion Size: 1155 bp. Deletion left flank: ACTAGCTTCCAAGTTGACTATATTAATATT. Deletion right flank: ACTGTAATTCACAAATTTTAGATAAGTTAA. Insertion Sequence: TTGACTATATTAAT.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032498 Copy
http://www.wormbase.org/db/get?name=WBStrain00032497
Source Database: WormBase (WB)
Affected Genes: WBGene00009861(fbxb-8)
Genomic Alteration: WBGene00009861(fbxb-8)
Availability: available
Source References: EMPTY
Synonyms: fbxb-8(ok2340) I.
Alternate IDs: WB-STRAIN:RB1806, CGC_RB1806
Notes: F49B2.1. Homozygous. Outer Left Sequence: TCGATTCGAATGGTTGTTCA. Outer Right Sequence: ACGTCATATGTGGCGCATTA. Inner Left Sequence: ACATAGGACACCCCTTGTCG. Inner Right Sequence: CCCGCATTTTTGTAGATCGT. Inner Primer PCR Length: 2880 bp. Deletion Size: 1799 bp. Deletion left flank: AGCTTCGATCACGATTCAGAGCAGTTTTGT. Deletion right flank: TCAATCCCGGCAATTTGCCGATTTACTGAA.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032497 Copy
http://www.wormbase.org/db/get?name=WBStrain00032495
Source Database: WormBase (WB)
Affected Genes: WBGene00020688(cest-6)
Genomic Alteration: WBGene00020688(cest-6)
Availability: available
Source References: EMPTY
Synonyms: T22D1.11(ok2338) IV.
Alternate IDs: WB-STRAIN:RB1804, CGC_RB1804
Notes: Made_by: OMRF Knockout Group|"T22D1.11 Homozygous. Outer Left Sequence: ttggggatgttcaattggtt. Outer Right Sequence: aacgactcaaaagctcagcc. Inner Left Sequence: atattggcagacacgcgatt. Inner Right Sequence: gccagagagctgctcaaaat. Inner Primer PCR Length: 2803. Deletion size: about 1600 bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032495 Copy
http://www.wormbase.org/db/get?name=WBStrain00032493
Source Database: WormBase (WB)
Affected Genes: WBGene00010060(F54E4.4)
Genomic Alteration: WBGene00010060(F54E4.4)
Availability: available
Source References: EMPTY
Synonyms: F54E4.4(ok2336) X.
Alternate IDs: WB-STRAIN:RB1802, CGC_RB1802
Notes: F54E4.4. Homozygous. Outer Left Sequence: CGATTGGGCCCTATTTAACA. Outer Right Sequence: TACAGCTGCCAGATGGATCA. Inner Left Sequence: TCATGTCTTATGGTGAAATTTTGG. Inner Right Sequence: AAGGAGTGAAGTGTGCAGAATG. Inner Primer PCR Length: 3144 bp. Deletion Size: 1217 bp. Deletion left flank: ACTCACTGTAGTAGTAGTTGTGGGTAAAGT. Deletion right flank: ATAAATGCGGGAAAAGCGGACGATCTTCTG.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032493 Copy
http://www.wormbase.org/db/get?name=WBStrain00032419
Source Database: WormBase (WB)
Affected Genes: WBGene00018414(nstp-8)
Genomic Alteration: WBGene00018414(nstp-8)
Availability: available
Source References: EMPTY
Synonyms: F44C8.7(ok2206) V.
Alternate IDs: WB-STRAIN:RB1727, CGC_RB1727
Notes: F44C8.7. Homozygous. Outer Left Sequence: CGGGATCTTGAAAATCTGGA. Outer Right Sequence: CGTCGCATTTGATGTTGAAT. Inner Left Sequence: TGAGCACATTTTGGGCCTAT. Inner Right Sequence: CTATCGCCCGGTAACACAGT. Inner Primer PCR Length: 2869 bp. Deletion Size: 1098 bp. Deletion left flank: TCTGAAAATTTAATTTTCAGTGCAAAATGA. Deletion right flank: TTACATGAGAAAATTCACGAAAAAGTTACA.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032419 Copy
http://www.wormbase.org/db/get?name=WBStrain00032418
Source Database: WormBase (WB)
Affected Genes: WBGene00006380(tab-1)|WBGene00017955(F31E8.5)
Genomic Alteration: WBGene00006380(tab-1), WBGene00017955(F31E8.5)
Availability: available
Source References: EMPTY
Synonyms: tab-1&F31E8.5(ok2198) II.
Alternate IDs: WB-STRAIN:RB1726, CGC_RB1726
Notes: F31E8.3, F31E8.5. Homozygous. Outer Left Sequence: GCACAAGTTGTTGGGGAAGT. Outer Right Sequence: TTTTTGTCTGGGGTTGGAAG. Inner Left Sequence: TCTTTCACGGGACCTTCATC. Inner Right Sequence: ATCGGAGAACACAAGTTGCC. Inner Primer PCR Length: 2481 bp. Deletion Size: 1702 bp. Deletion left flank: TAAAATATGTAAATTTGATCATCAAAAATT. Deletion right flank: TCAATCCTCCAACGGATTCACATGTCTTCT.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032418 Copy
http://www.wormbase.org/db/get?name=WBStrain00032416
Source Database: WormBase (WB)
Affected Genes: WBGene00009643(F42G4.6)
Genomic Alteration: WBGene00009643(F42G4.6)
Availability: available
Source References: EMPTY
Synonyms: F42G4.6(ok2196) II.
Alternate IDs: WB-STRAIN:RB1724, CGC_RB1724
Notes: F42G4.6. Homozygous. Outer Left Sequence: CTGCCTACCTATCTGCCTGC. Outer Right Sequence: AAGAAGGCTCCTCGCATACA. Inner Left Sequence: AACAGGTTCATTTTGCGGTC. Inner Right Sequence: GAAATGGAAGAATTTGCCGA. Inner Primer PCR Length: 2746 bp. Deletion Size: 1759 bp. Deletion left flank: TGTTTCAAGCACAACGGTCAGTGTACCTAC. Deletion right flank: CCAAAAATTTTATTCAGAATTGTAATAATT. Insertion Sequence: CAACGGTCAGTGTACCTA.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032416 Copy
http://www.wormbase.org/db/get?name=WBStrain00032415
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: C27H2.2(ok2191) IV.
Alternate IDs: WB-STRAIN:RB1723, CGC_RB1723
Notes: C27H2.2. Homozygous. Outer Left Sequence: TTCCGAATTGTTTGGCTTTC. Outer Right Sequence: TTTACAATCGCGTGTTGCTC. Inner Left Sequence: CAATTTCACCCTTCGATGCT. Inner Right Sequence: TTTGCCATTGTGCCAATAAA. Inner Primer PCR Length: 2901 bp. Deletion Size: 703 bp. Deletion left flank: ACTTTTTTCCGAATTTCGAATATTGTAAAA. Deletion right flank: GGCACCCTTCCGGCTCCGTCGAGCAAGAAA.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032415 Copy
http://www.wormbase.org/db/get?name=WBStrain00032412
Source Database: WormBase (WB)
Affected Genes: WBGene00013694(mekk-3)
Genomic Alteration: WBGene00013694(mekk-3)
Availability: available
Source References: EMPTY
Synonyms: Y106G6A.1(ok2178) I.
Alternate IDs: WB-STRAIN:RB1720, CGC_RB1720
Notes: Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y10G6A.1. Homozygous. Outer Left Sequence: GGCATCTTCCCATTCGAGTA. Outer Right Sequence: GAGTCATCGGTTACCGTCGT. Inner Left Sequence: CCTGTGCTCAACTCTGCTTG. Inner Right Sequence: TAAATTCGAATGGCGGTCTC. Inner Primer PCR Length: 2210 bp. Deletion Size: 1007 bp. Deletion left flank: GTTTTAAATATTATTTTTACCGTAAAATTC. Deletion right flank: AAGTTTGTTCAATGTTTTGAAAACCGTAGC."
Proper citation: RRID:WB-STRAIN:WBStrain00032412 Copy
http://www.wormbase.org/db/get?name=WBStrain00032420
Source Database: WormBase (WB)
Affected Genes: WBGene00006606(tra-3)
Genomic Alteration: WBGene00006606(tra-3)
Availability: available
Source References: PMID:37628820
Synonyms: tra-3(ok2207) IV.
Alternate IDs: WB-STRAIN:RB1728, CGC_RB1728
Notes: LLC1.1. Homozygous. Outer Left Sequence: TTGAGCACAACCTGAAGCAG. Outer Right Sequence: AAAACTCCTATTTGCCCGCT. Inner Left Sequence: TCACAGTTTTCGGGTTTTCC. Inner Right Sequence: AGATGTTTCCGGTGGAGTTG. Inner Primer PCR Length: 3226 bp. Deletion Size: 1474 bp. Deletion left flank: AAAGAACTGAAGTTATGTTTATTGGTTAAT. Deletion right flank: TCTCATTTTGAACTAGAAACTATTGCTAAC. Insertion Sequence: CTTCAGAAAAATATTACAAATTGTATCTTTTTACACAAGATTTTAAATTTTTAAAAATA AAATCTGAAACAATTTTGTCTAATAAAAACAAAGGCCCTCATGAATTGTTTATGAAAAT TATCACCCAAATAAGTTGATTAACTTGGGCGGGGCTTATTTTACAGGTTTTGA.|"LLC1.1. Homozygous. Outer Left Sequence: TTGAGCACAACCTGAAGCAG. Outer Right Sequence: AAAACTCCTATTTGCCCGCT. Inner Left Sequence: TCACAGTTTTCGGGTTTTCC. Inner Right Sequence: AGATGTTTCCGGTGGAGTTG. Inner Primer PCR Length: 3226 bp. Deletion Size: 1474 bp. Deletion left flank: AAAGAACTGAAGTTATGTTTATTGGTTAAT. Deletion right flank: TCTCATTTTGAACTAGAAACTATTGCTAAC. Insertion Sequence: CTTCAGAAAAATATTACAAATTGTATCTTTTTACACAAGATTTTAAATTTTTAAAAATAAAATCTGAAACAATTTTGTCTAATAAAAACAAAGGCCCTCATGAATTGTTTATGAAAATTATCACCCAAATAAGTTGATTAACTTGGGCGGGGCTTATTTTACAGGTTTTGA."|"Made_by: OMRF Knockout Group"|"Supplementary_genotype tra-3 (ok2207)"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032420 Copy
http://www.wormbase.org/db/get?name=WBStrain00032425
Source Database: WormBase (WB)
Affected Genes: WBGene00015686(C10G11.6)
Genomic Alteration: WBGene00015686(C10G11.6)
Availability: available
Source References: EMPTY
Synonyms: C10G11.6(ok2212) I.
Alternate IDs: WB-STRAIN:RB1733, CGC_RB1733
Notes: C10G11.6. Homozygous. Outer Left Sequence: GACGAAGACGACGAAGAAGG. Outer Right Sequence: GGGGTACCCGATGAGCTACT. Inner Left Sequence: TTTACCACGGAAAACCTTCG. Inner Right Sequence: TTTTGGTGATTCATCGGGTT. Inner Primer PCR Length: 3386 bp. Deletion Size: 1357 bp. Deletion left flank: TTCCGTCTCCGTTTGTTCGAAAAATTCCCG. Deletion right flank: TTCCTCCGCCAGGACTCGTTGGAATCAATG.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032425 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
