Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
syIs537; syIs300 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055224 | Caenorhabditis elegans | syIs537; syIs300 | Made_by: Jun Young Oh/Shahla Gharib|"syIs537 [glr-3p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for RIA neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFPmarker, but will consistently produce worms with the transgenic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148." | WB-STRAIN:WBStrain00055224 | WormBase (WB) | WB | unknown | 2026-09-05 04:58:06 | 0 | ||||||
|
syIs532; syIs300 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055221 | Caenorhabditis elegans | syIs532; syIs300 | Made_by: Jun Young Oh/Shahla Gharib|"syIs532 [hlh-34p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for AVH neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFPmarker, but will consistently produce worms with the transgenic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148." | WB-STRAIN:WBStrain00055221 | WormBase (WB) | WB | unknown | 2026-09-05 04:58:05 | 0 | ||||||
|
syIs561. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055228 | Caenorhabditis elegans | syIs561. | Made_by: Jun Young Oh/Shahla Gharib|"syIs561 [ttx-3p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for AIY neurons." | WB-STRAIN:WBStrain00055228 | WormBase (WB) | WB | unknown | 2026-09-05 04:58:06 | 0 | ||||||
|
utsIs3. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055193 | Caenorhabditis elegans | utsIs3. | utsIs3 [rab-11.2p::YFP::unc-54 3'UTR]. Transcriptional reporter for rab-11.2 activation. YFP expression is low at baseline and activated in the intestine by lipid depletion. Reference: Watterson A, et al. Nature. 2022 May;605(7911):736-740. doi: 10.1038/s41586-022-04729-7. PMID: 35585236. | WB-STRAIN:WBStrain00055193 | WormBase (WB) | WB | unknown | 2026-09-05 04:58:05 | 0 | ||||||
|
utsIs4. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055194 | Caenorhabditis elegans | utsIs4. | utsIs4 [nhr-49p::nhr-49::GFP + myo-2p::mCherry]. Strain was back-crossed to N2 following transgene integration (parental strain described in Ratnappan R, et al. PLoS Genet. 2014 Dec 4;10(12):e1004829. doi: 10.1371/journal.pgen.1004829. ). Reference: Watterson A, et al. Nature. 2022 May;605(7911):736-740. doi: 10.1038/s41586-022-04729-7. PMID: 35585236. | WB-STRAIN:WBStrain00055194 | WormBase (WB) | WB | unknown | 2026-09-05 04:58:05 | 0 | ||||||
|
tns-1(sy1813) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055333 | Caenorhabditis elegans | tns-1(sy1813) I. | Made_by: Heenam Park|"Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of tns-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATTCTCTAGAGTTATACAAAGACAAATTAGTGGTGC. Right flanking sequence: AGGAGGTGGAATTCTAAAGAAGAGTAATGGAAAG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGACAAATTAGTGGTGCAGG Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616." | WBGene00006508(tns-1) | WBGene00006508(tns-1) | WB-STRAIN:WBStrain00055333 | WormBase (WB) | WB | unknown | PMID:39999212 | 2026-09-05 04:58:07 | 0 | |||
|
oac-45(sy1742) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055299 | Caenorhabditis elegans | oac-45(sy1742) I. | Made_by: Heenam Park|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-45. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTTCTTGGATTTCATTTCTACCCTAATCAGTTTCCC right flanking sequence: AATGGGTACCTTGGAGTTGATCAgtaaggtttttag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACCCTAATCAGTTTCCCAAT Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616" | WBGene00011656(oac-45) | WBGene00011656(oac-45) | WB-STRAIN:WBStrain00055299 | WormBase (WB) | WB | unknown | 2026-09-05 04:58:07 | 0 | ||||
|
syIs799; syIs300. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055335 | Caenorhabditis elegans | syIs799; syIs300. | Made_by: Stephanie Nava/Shahla Gharib|"syIs799 [F58F6.6p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for PHC neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation." | WB-STRAIN:WBStrain00055335 | WormBase (WB) | WB | unknown | 2026-09-05 04:58:07 | 0 | ||||||
|
col-102(sy1735) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055296 | Caenorhabditis elegans | col-102(sy1735) IV. | Made_by: Heenam Park|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-102. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GATGAGGTCTCTCAAGATCTTACACAATTCCGTGG right flanking sequence: ATACTATGATGATGCGTGGAGAACCATGATGGTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACGCATCATCATAGTATCCA Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616" | WBGene00000676(col-102) | WBGene00000676(col-102) | WB-STRAIN:WBStrain00055296 | WormBase (WB) | WB | unknown | 2026-09-05 04:58:07 | 0 | ||||
|
syIs768; syIs300. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055295 | Caenorhabditis elegans | syIs768; syIs300. | Made_by: Stephanie Nava/Shahla Gharib|"syIs768 [aqp-6p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for IL1 neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation." | WB-STRAIN:WBStrain00055295 | WormBase (WB) | WB | unknown | 2026-09-05 04:58:07 | 0 | ||||||
|
srd-32(sy1785) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055322 | Caenorhabditis elegans | srd-32(sy1785) V. | Made_by: Heenam Park|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srd-32. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CACCATATACTGTATTCTTGGCGAACACCTCTA right flanking sequence: TAACGCAGCTAGGGTATTGCATATGTTTCCTCTTAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATACCCTAGCTGCGTTATAG Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616" | WBGene00005110(srd-32) | WBGene00005110(srd-32) | WB-STRAIN:WBStrain00055322 | WormBase (WB) | WB | unknown | 2026-09-05 04:58:07 | 0 | ||||
|
mgl-1(sy1623) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055288 | Caenorhabditis elegans | mgl-1(sy1623) X. | Made_by: Heenam Park|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of mgl-1. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTGCACTTATTCTTGATTCATGCTCAAATCCAGCA right flanking sequence: TATGCGCTAAACCAGAGTTTAGATTTTGTGAGAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTCTGGTTTAGCGCATATGC Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616" | WBGene00003232(mgl-1) | WBGene00003232(mgl-1) | WB-STRAIN:WBStrain00055288 | WormBase (WB) | WB | unknown | 2026-09-05 04:58:06 | 0 | ||||
|
col-73(sy1792) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055324 | Caenorhabditis elegans | col-73(sy1792) II. | Made_by: Heenam Park|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-73. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GACCAGATGCTCCAAATGAGCACGTTCAACCAACT right flanking sequence: CCAGCCGATTTCTGCTTCGAGTGCCCACCAGGACC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAGCAGAAATCGGCTGGAGT Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616" | WBGene00000649(col-73) | WBGene00000649(col-73) | WB-STRAIN:WBStrain00055324 | WormBase (WB) | WB | unknown | 2026-09-05 04:58:07 | 0 | ||||
|
flp-22(sy1608) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055285 | Caenorhabditis elegans | flp-22(sy1608) I. | Made_by: Heenam Park|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of flp-22. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCTTTGTGTTGTTTTGATGGTATCATTGGTGTCGG right flanking sequence: CTCAGGTCTTCGATTTGGATGGACAACAGTTGGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGTATCATTGGTGTCGGCTC Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616" | WBGene00009562(flp-22) | WBGene00009562(flp-22) | WB-STRAIN:WBStrain00055285 | WormBase (WB) | WB | unknown | 2026-09-05 04:58:06 | 0 | ||||
|
syIs612. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055284 | Caenorhabditis elegans | syIs612. | Made_by: Jun Young Oh/Mark Zhang|"syIs612 [15xUAS::GCaMP7b::SL2::mKate::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. In vivo calcium indicator cGAL effector." | WB-STRAIN:WBStrain00055284 | WormBase (WB) | WB | unknown | 2026-09-05 04:58:06 | 0 | ||||||
|
him-5(e1490) V; str-74(sy1802) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055329 | Caenorhabditis elegans | him-5(e1490) V; str-74(sy1802) X. | Made_by: Heenam Park|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of str-74 in him-5(e1490) background. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGGAATATTGTTTTCGGGAATAGAAATCCTTGC right flanking sequence: CAGACCATTCGCTCATAATTATAACAACAGTTTGATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TATGAGCGAATGGTCTGGCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616" | WBGene00001864(him-5)|WBGene00006135(str-74) | WBGene00001864(him-5), WBGene00006135(str-74) | WB-STRAIN:WBStrain00055329 | WormBase (WB) | WB | unknown | 2026-09-05 04:58:07 | 0 | ||||
|
ufd-3(sy1796) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055326 | Caenorhabditis elegans | ufd-3(sy1796) II. | Made_by: Heenam Park|"Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of ufd-3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into the 1st one of the exons shared by all isoforms of the gene. Left flanking sequence: CTCATCATTCACTGAATTCGTATTTCTGTGATCGTGA. Right flanking sequence: ACGTGGTCAGGAACTTGTCGGAAGATTAATTGC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TATTTCTGTGATCGTGAACG Method Reference: Wang H, et al. G3 (Bethesda).2018 Nov 6;8(11):3607-3616." | WBGene00007333(ufd-3) | WBGene00007333(ufd-3) | WB-STRAIN:WBStrain00055326 | WormBase (WB) | WB | unknown | 2026-09-05 04:58:07 | 0 | ||||
|
col-54(sy1630) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055291 | Caenorhabditis elegans | col-54(sy1630) I. | Made_by: Heenam Park|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-54. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAGTCTTCTTGTTGCTGGATCATTATTCTTTGAAGC right flanking sequence: TCAAGGATTTTTAGAGACTTCACTTGATGAAATTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCATTATTCTTTGAAGCTCA Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616" | WBGene00000631(col-54) | WBGene00000631(col-54) | WB-STRAIN:WBStrain00055291 | WormBase (WB) | WB | unknown | 2026-09-05 04:58:07 | 0 | ||||
|
syIs748; syIs300. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055293 | Caenorhabditis elegans | syIs748; syIs300. | Made_by: Stephanie Nava/Shahla Gharib|"syIs748 [tbh-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for RIC neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation." | WB-STRAIN:WBStrain00055293 | WormBase (WB) | WB | unknown | 2026-09-05 04:58:07 | 0 | ||||||
|
col-40(sy1628) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055290 | Caenorhabditis elegans | col-40(sy1628) II. | Made_by: Heenam Park|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-40. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: aactattttcagGTCGAATTCTGCAAGCACCGAAC right flanking sequence: TGACGGACTCTGGGATGAGTTCCACAGAgtaagta inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCTGCAAGCACCGAACTGA Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616" | WBGene00000617(col-40) | WBGene00000617(col-40) | WB-STRAIN:WBStrain00055290 | WormBase (WB) | WB | unknown | 2026-09-05 04:58:06 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
