Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=153297754
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2022-07-21)
Alternate IDs: 153297754
Notes: This strain was produced at the Medical College of Wisconsin using CRISPR Cas9 mutagenesis in the Crl:SD strain. A CRISPR SpCas9/sgRNA targeting the GTCCTTTGCAGTCCCTGCCG sequence within exon 15 of Gsap and a 5-bp indel (rn72: chr4:13,849,488-13,849,492) was identified.
Proper citation: RRID:RGD_153297754 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=626419679
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo (as of 2025-09-05)
Alternate IDs: 626419679
Notes: Crl:CD(SD)-KO(Gnal*135)44-178Hpng/Hpng rats were generated by CRISPR/Cas9 technology. A deletion of 135 base pairs, corresponding to position 44-178, downstream of the translation initiation start ATG of the Gnal splicing variant 2, results in a deletion mutation. CRISPR technology details: self-synthesized Cas9 mRNA using px 330 vector, applying T7 transcription kit followed by Poly-Adenylation and Capping. No sequencing performed, whether Cas9 has been inserted into the rat genome is unknown. European Mouse Mutant Archive(EMMA)
Proper citation: RRID:RGD_626419679 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=405100724
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 405100724
Notes: This mutant rat was produced by targeted knocking adding in IRES-iCre to the 3' end of Pdyn in LE rat using CRISPR/Cas9 method. Optogenetics and Transgenic Technology Core
Proper citation: RRID:RGD_405100724 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=616572761
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 616572761
Notes: This is the wild type littermate of SD-CdCSem1Bcgen+/- (RGD:616390066). The mutant CdCS rat has the 5p15.2 deletion in the genome and it a rat model for human Cri du Chat Syndrome .
Proper citation: RRID:RGD_616572761 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13441560
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 13441560
Notes: CRISPR/Cas9 system was used to introduce a 2-base pair insertion mutation into exon 6 in the rat Galt gene of Crl:SD embryos
Proper citation: RRID:RGD_13441560 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=625777904
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 625777904
Notes: To produce Pxr KO rats, A pair of TALEN mRNAs targeting Nr1i2 (Pxr) was injected into rat fertilized eggs.This strain was derived from a founder harbouring a16 bp deletion (rPxr-KO).
Proper citation: RRID:RGD_625777904 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=625777901
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 625777901
Notes: To produce Cyp3a (∼560-kb) KO rats, A pair of TALEN mRNAs targeting exon 5 of rat Cyp3a23/3a1 and Cyp3a2 were injected into rat fertilized eggs. A founder with homozygous big deletion (BD) mutation from No. 58 line selected.
Proper citation: RRID:RGD_625777901 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=19165366
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2026-03-03)
Alternate IDs: 19165366
Notes: Cas9 protein and sgRNA targeting the sequence CCTTTTTGCAGAGCACGAAA within exon 2 of Adcy3 were injected into embryos of the WKY/NCrl strain. A 1-bp deletion resulted (rn7: chr6:27,126,062).The homozygous mutant was lethal shortly after birth, so the heterozygous +/- was used for study. Contact Dr. Solberg-Woods at Wake Forest University School of Medicine, Email: [email protected]
Proper citation: RRID:RGD_19165366 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=625777902
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 625777902
Notes: To produce Cyp3a (∼560-kb) KO rats, A pair of TALEN mRNAs targeting exon 5 of rat Cyp3a23/3a1 and Cyp3a2 were injected into rat fertilized eggs. A founder with 9-bp deletion mutation from No. 65 line selected.
Proper citation: RRID:RGD_625777902 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=1302639
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24)
Alternate IDs: 1302639
Notes: Kaken hairless rat were detected by Kimura from Gunn National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_1302639 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=1358923
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 1358923
Notes: A spontaneous tremor rat was originated from in-house breeding colony , after purchased from Charles River Laboratory 12 years earlier, at McMaster University Central Animal Facility, Hamilton, Ontario, Canada. 10-12 days old rats had tremors that were followed by ataxia, hind limb paresis, episodes of immobility, and seizures by 5-14 weeks.
Proper citation: RRID:RGD_1358923 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=1579690
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct (as of 2017-01-26)
Alternate IDs: 1579690
Notes: Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. K196Stop is generated.
Proper citation: RRID:RGD_1579690 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=1579677
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct (as of 2017-01-26)
Alternate IDs: 1579677
Notes: Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. G120R mutation is generated.
Proper citation: RRID:RGD_1579677 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=1579708
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct (as of 2017-01-26)
Alternate IDs: 1579708
Notes: Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. S25T mutation is generated.
Proper citation: RRID:RGD_1579708 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=1599768
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 1599768
Notes: Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V243I mutation is generated from the codon change GTC/ATC.
Proper citation: RRID:RGD_1599768 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=1599766
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 1599766
Notes: Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. L67R mutation is generated from the codon change CTG/CGG.
Proper citation: RRID:RGD_1599766 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=1599765
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 1599765
Notes: Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I150N mutation is generated from the codon change ATC/AAC.
Proper citation: RRID:RGD_1599765 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=1581636
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 1581636
Notes: Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E37G mutation is generated from the codon change GAG/GGG.
Proper citation: RRID:RGD_1581636 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=1581637
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct (as of 2017-01-26)
Alternate IDs: 1581637
Notes: Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. F55L mutation is generated from the codon change TTT/TTG.
Proper citation: RRID:RGD_1581637 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=1581634
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct (as of 2016-10-24)
Alternate IDs: 1581634
Notes: Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. C249S mutation is generated from the codon change TGT/AGT of rat Adora2a.
Proper citation: RRID:RGD_1581634 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
