Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
VC4217 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037954 | Caenorhabditis elegans | oac-56(gk5303[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 4391 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CCATGTCATCTGGCCTAGTTACAGCGTAGT ; Right flanking sequence: ATTGGATGTCTTCTCGCATTGTGGTAAAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00013450(oac-56) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00013450(oac-56) | WB-STRAIN:WBStrain00037954 | WormBase (WB) | WB | available | WB-STRAIN:VC4217, CGC_VC4217 | 2026-08-29 09:23:35 | 0 | |||
|
VC4220 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037955 | Caenorhabditis elegans | frpr-16(gk5305[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. | Homozygous viable. Deletion of 1685 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCATAATTGTTTGTTTGACAAAAACCGGGA ; Right flanking sequence: GGTGGAAACGGAAATGAAAGAAAAAACCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1704 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCATAATTGTTTGTTTGACAAAAACCGGGA ; Right flanking sequence: GGTGGAAACGGAAATGAAAGAAAAAACCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00020023(frpr-16) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00020023(frpr-16) | WB-STRAIN:WBStrain00037955 | WormBase (WB) | WB | available | WB-STRAIN:VC4220, CGC_VC4220 | 2026-08-29 09:23:37 | 0 | |||
|
VC4207 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037952 | Caenorhabditis elegans | ugt-6 | Homozygous viable. Deletion of 1469 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCGTGTTTTACCATCAGATCAGTTGGCGTG ; Right flanking sequence: GATGGAATATGCTGCCTTCCAAGTTCATCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00013904(ugt-6) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00013904(ugt-6) | WB-STRAIN:WBStrain00037952 | WormBase (WB) | WB | available | PMID:38488606 | WB-STRAIN:VC4207, CGC_VC4207 | 2026-08-29 09:23:37 | 0 | ||
|
VC4128 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037929 | Caenorhabditis elegans | irk-2(gk5210[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. | Homozygous viable. Deletion of 2391 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTACCTGCAACCGAACATGCGCTTCCGCCA ; Right flanking sequence: TCCGTTGAGCTGTGAAAATATCAGTTACAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00002150(irk-2)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00002150(irk-2), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00037929 | WormBase (WB) | WB | available | WB-STRAIN:VC4128, CGC_VC4128 | 2026-08-29 09:23:32 | 0 | |||
|
VC4155 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037936 | Caenorhabditis elegans | gbh-2(gk5238[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. | Homozygous viable. Deletion of 1500 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGCTTGTATCAGGTTTCACATGGGTTACCG ; Right flanking sequence: CAGGGAAGTCACAAACTTCTTTATGAATAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00001523(gbh-2)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00001523(gbh-2), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00037936 | WormBase (WB) | WB | available | WB-STRAIN:VC4155, CGC_VC4155 | 2026-08-29 09:23:34 | 0 | |||
|
VC4159 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037937 | Caenorhabditis elegans | lbp-9(gk5245[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. | Homozygous viable. Deletion of 406 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAGAGAAACATGCCAATTCAAACCGATCTT ; Right flanking sequence: ACGGAGTCAAGTGCACTCGCGTCTACGAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00021486(lbp-9) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00021486(lbp-9) | WB-STRAIN:WBStrain00037937 | WormBase (WB) | WB | available | WB-STRAIN:VC4159, CGC_VC4159 | 2026-08-29 09:23:37 | 0 | |||
|
VC4144 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037934 | Caenorhabditis elegans | C50D2.2(gk5227[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. | Homozygous viable. Deletion of 1425 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAACGTGTATTTCGTCTGAAAAACTTGCCG ; Right flanking sequence: GGAGGAAAACTTCGATTCAGCATTCCATTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00037934 | WormBase (WB) | WB | available | WB-STRAIN:VC4144, CGC_VC4144 | 2026-08-29 09:23:37 | 0 | |||
|
VC4147 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037935 | Caenorhabditis elegans | F23F1.6(gk5230[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. | Homozygous viable. Deletion of 1753 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATCATGAAGACATTGATGAGTAGACCAAGG ; Right flanking sequence: TCAAATGTCTTTTTACGAAACAAGACATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00037935 | WormBase (WB) | WB | available | WB-STRAIN:VC4147, CGC_VC4147 | 2026-08-29 09:23:33 | 0 | |||
|
VC4163 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037939 | Caenorhabditis elegans | Y53F4B.12(gk5249[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. | Homozygous viable. Deletion of 3837 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCTCTTCATTATTCTACCCTTCTCACTAAC ; Right flanking sequence: GGTCTACCTTCAACACTACTACCCGGAACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. [NOTE: The correct genotype of this strain is Y53F4B.12(gk5249). The strain was incorrectly identified as Y53F4B.13 when this strain was sent to the CGC.]|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00037939 | WormBase (WB) | WB | available | WB-STRAIN:VC4163, CGC_VC4163 | 2026-08-29 09:23:34 | 0 | |||
|
VC4141 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037932 | Caenorhabditis elegans | nipa-1(gk5224[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. | Homozygous viable. Deletion of 3485 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAAAAAAAGAACAAAAACTGGGTGAGGATC ; Right flanking sequence: ATACCCATAACCGCCTTCCGATGCCCGTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00021820(nipa-1) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00021820(nipa-1) | WB-STRAIN:WBStrain00037932 | WormBase (WB) | WB | available | WB-STRAIN:VC4141, CGC_VC4141 | 2026-08-29 09:23:32 | 0 | |||
|
VC4143 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037933 | Caenorhabditis elegans | ptr-21(gk5226[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. | Homozygous viable. Deletion of 3539 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGCATCGGATCAAGTATTTGGAAGAAGCAC ; Right flanking sequence: CTCAGTTGGCCTAGCGACCGCTTCGATTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004235(ptr-21)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004235(ptr-21), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00037933 | WormBase (WB) | WB | available | WB-STRAIN:VC4143, CGC_VC4143 | 2026-08-29 09:23:34 | 0 | |||
|
VC4137 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037930 | Caenorhabditis elegans | ptr-9(gk5220[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. | Homozygous viable. Deletion of 2787 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GATAATATCAAGTCGTGTATTTGTAGCTGC ; Right flanking sequence: GATGTCTGAAAATGTTTTAAATAATTCATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004223(ptr-9)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004223(ptr-9), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00037930 | WormBase (WB) | WB | available | WB-STRAIN:VC4137, CGC_VC4137 | 2026-08-29 09:23:34 | 0 | |||
|
VC4139 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037931 | Caenorhabditis elegans | ptr-22(gk5222[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. | Homozygous viable. Deletion of 4054 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCAAAAACGGCGGAAAAAATGGAGATGAGG ; Right flanking sequence: ATACTGGAGTAGTCGAAAGTACACCATTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004236(ptr-22)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004236(ptr-22), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00037931 | WormBase (WB) | WB | available | WB-STRAIN:VC4139, CGC_VC4139 | 2026-08-29 09:23:37 | 0 | |||
|
F39H12.2(gk5395[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051133 | Caenorhabditis elegans | F39H12.2(gk5395[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. | Homozygous viable. Deletion of 2876 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: ACTGAGAGAGAGAAAGCTAGTTAGCCGCGG. Right flanking sequence: CATGGGAGCGCAATTCACAAATGGACGCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051133 | WormBase (WB) | WB | unknown | 2026-08-29 09:27:32 | 0 | ||||
|
iglr-3(gk5399[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051135 | Caenorhabditis elegans | iglr-3(gk5399[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 8123 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CTCAAACGAAACACAGCTCGGCTCGTCGAA. Right flanking sequence: TGGAATATCTGAAGAAAAAAAGTGCGGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00021353(iglr-3) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00021353(iglr-3) | WB-STRAIN:WBStrain00051135 | WormBase (WB) | WB | unknown | 2026-08-29 09:27:32 | 0 | ||||
|
nbs-1(gk5291[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051121 | Caenorhabditis elegans | nbs-1(gk5291[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1281 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GTTTTTATTCACACGGTATATTGGGAGCAT. Right flanking sequence: TCTTTCAACACATAAACCTCTAGAAGGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00007504(nbs-1) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00007504(nbs-1) | WB-STRAIN:WBStrain00051121 | WormBase (WB) | WB | unknown | 2026-08-29 09:27:32 | 0 | ||||
|
prp-4(gk5373[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051126 | Caenorhabditis elegans | prp-4(gk5373[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. | Made_by: Vancouver KO Group|"[NOTE: Please see RG5026 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1874 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ATTGGCCAGCAGCATCAGCACGCACCCGGG. Right flanking sequence: TGTCTTGGCGGTGCTGGAACAGCAAAATTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00007972(prp-4) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00007972(prp-4) | WB-STRAIN:WBStrain00051126 | WormBase (WB) | WB | unknown | 2026-08-29 09:27:32 | 0 | ||||
|
tasp-1(gk3684[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051092 | Caenorhabditis elegans | tasp-1(gk3684[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. | Homozygous viable. Deletion of 57 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAATCCTTCTGAAACATCGATTCAGTGGAG. Right flanking sequence: AGGTTTGCGCACACTAATTATCGATTTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00010480(tasp-1) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00010480(tasp-1) | WB-STRAIN:WBStrain00051092 | WormBase (WB) | WB | unknown | 2026-08-29 09:27:31 | 0 | ||||
|
lron-2(gk5159[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051111 | Caenorhabditis elegans | lron-2(gk5159[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2328 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ATTAAAAAGAAACGCTTTGATTTACCTAGA. Right flanking sequence: GAAGGATTGTGAAACTTTGGAAGGCATTCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00022789(lron-2) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00022789(lron-2) | WB-STRAIN:WBStrain00051111 | WormBase (WB) | WB | unknown | 2026-08-29 09:27:32 | 0 | ||||
|
aps-1(gk5143[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051110 | Caenorhabditis elegans | aps-1(gk5143[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 738 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CATGATGCAATACATGCTTCTCTTCAGTCG. Right flanking sequence: TTGGGATAATGAAGATAATAGTAACATAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00000159(aps-1)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00000159(aps-1), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051110 | WormBase (WB) | WB | unknown | 2026-08-29 09:27:32 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
