Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 42 showing 821 ~ 840 out of 4,651 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=8551772

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 8551772
Notes: A triple congenic strain derived from the progenitor strain SS.MNS-(D2Chm33-Tm2sf1)/Ayd and SS.LEW-(D10Rat194-D10Chm243)(D10Chm10-D10Rat11)/Ayd

Proper citation: RRID:RGD_8551772 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=8655660

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 8655660
Notes: desired region was introgressed from OXYS/Nov into the genetic background of WAG/Nov by first intercrossing and then backcrossing to WAG/Nov

Proper citation: RRID:RGD_8655660 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=8551892

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 8551892
Notes: Congenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.

Proper citation: RRID:RGD_8551892 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7241811

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 7241811
Notes: a double congenic strain which has more than 38.74 Mb of chr 8 and more than 16.78 Mb of chr 13 of Wistar Furth introgressed into the gentic background of BBDP/WorSunn

Proper citation: RRID:RGD_7241811 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7248729

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 7248729
Notes: This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.

Proper citation: RRID:RGD_7248729 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7248727

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Live Animals (as of 2017-09-07)
Alternate IDs: 7248727
Notes: This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.

Proper citation: RRID:RGD_7248727 Copy   


  • RRID:RGD_9587829

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=9587829

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Live Animals (as of 2018-03-28)
Alternate IDs: 9587829
Notes: Imported from NIH in 1995, now maintained at National Laboratory Animal Center, Taiwan National Laboratory Animal Center, Taiwan

Proper citation: RRID:RGD_9587829 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7794706

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 7794706
Notes: male and female pairs of the monocongenic SS.LEW-(D5Mco39-D5Mco41)/Mco and SS.LEW-(D5Mco42-D5Mco47)/2Mco were randomly selected and intercrossed to get F1; the heterozygous animals for the desired region were intercrossed to get the bicongenics

Proper citation: RRID:RGD_7794706 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7794704

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 7794704
Notes: SS.LEW-(D5Mco34-D5Rat108)/Jr was selectively backcrossed with the SS/Jr strain

Proper citation: RRID:RGD_7794704 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=8551778

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 8551778
Notes: A double congenic strain derived from the progenitor strain SS.MNS-(D2Chm33-Tm2sf1)/Ayd and SS.LEW-(D3Rat2-D3Chm79)/Ayd

Proper citation: RRID:RGD_8551778 Copy   


  • RRID:RGD_8552235

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=8552235

Source Database: Rat Genome Database (RGD)
Genetic Background: transgenic
Availability: Cryopreserved Sperm (as of 2017-08-17)
Alternate IDs: 8552235
Notes: SV40 Large T Antigen along with Rat probasin promoter National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_8552235 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6907076

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 6907076
Notes: A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm.

Proper citation: RRID:RGD_6907076 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6907078

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 6907078
Notes: A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm.

Proper citation: RRID:RGD_6907078 Copy   


  • RRID:RGD_9586448

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=9586448

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 9586448
Notes: Substrain of SHR originally from Charles River now maintained at University of California

Proper citation: RRID:RGD_9586448 Copy   


  • RRID:RGD_7248716

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7248716

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Live Animals
Alternate IDs: 7248716
Notes: This is an inbred anophthalmic rat strain derived from a Sprague-Dawley (SD) colony and designated it as Nodai aphakia (NAK) by Dr.Ryoichi Hashizume in Tokyo University of Agriculture. The NAK rats have decreased body size than wild-type rats and do not have both eyes.

Proper citation: RRID:RGD_7248716 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=8552247

Source Database: Rat Genome Database (RGD)
Genetic Background: transgenic
Availability: Cryopreserved Sperm (as of 2017-08-17)
Alternate IDs: 8552247
Notes: This rat carries a transgene consisting of the NeuroD6 promoter followed by a STOP cassette flanked by FRT sites. The stop cassette consists of an mcherry gene encoding for a red fluorescent protein and a kanamycin resistant gene and three SV40polyA adenylation signals. The STOP cassette is followed by a gene encoding for the human diphtheria toxin receptor. This model is yet to be validated. National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_8552247 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11354930

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 11354930
Notes: This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Rat84)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again to duplicate the recombinant region.

Proper citation: RRID:RGD_11354930 Copy   


  • RRID:RGD_8552242

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=8552242

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Cryopreserved Embryo
Alternate IDs: 8552242
Notes: Developed by the DEPOSITOR National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_8552242 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054307

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 10054307
Notes: The Btg2 mutant rats were generated using transcription activator-like effector nuclease (TALEN) constructs specific for the rat Btg2 gene designed to target exon 1 using the target sequence TAGGTTTCCTCACCAGTCtcctgaggactcggggcTGCGTGAGCGAGCAGAGA. The result was a 44-bp deletion mutation in exon 1 (RNO13:50,916,769-50,916,812; aaaccttgagtctctgctcgctcacgcagccccgagtcctcagg) of SS.BN-(D13Rat25-rs106935835)/Mcwi rat embryos. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_10054307 Copy   


  • RRID:RGD_10054433

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054433

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2018-10-22)
Alternate IDs: 10054433
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Pkd1 gene of LEW/NCrl rat embryos. The resulting mutation is a 12-bp deletion in the Pkd1 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_10054433 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X