Organisms   Select Another Resource Report Type

http://www.wormbase.org/db/get?name=WBStrain00035584

Source Database: WormBase (WB)
Affected Genes: WBGene00000391(cdd-1)
Genomic Alteration: WBGene00000391(cdd-1)
Availability: available
Source References: PMID:32049015
Synonyms: cdd-1(ok390) X.
Alternate IDs: WB-STRAIN:VC208, CGC_VC208
Notes: C47D2.2. Superficially wild type.|"Mutagen:UV/TMP"|"Reference WBPaper00059294 added based on published strain data identified by Textpresso literature search."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035584 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00035593

Source Database: WormBase (WB)
Affected Genes: WBGene00000553(cmk-1)|WBGene00044213(Y102A5C.36)
Genomic Alteration: WBGene00000553(cmk-1), WBGene00044213(Y102A5C.36)
Availability: available
Source References: EMPTY
Synonyms: cmk-1(ok287) IV; gkDf56 Y102A5C.36(gk3558) V.
Alternate IDs: WB-STRAIN:VC220, CGC_VC220
Notes: Mutagen:UV/TMP|"This strain is homozygous for a deletion (ok287) in K07A9.2, detectable by PCR using the following primers. External left primer: CAGTGCCTTTAGGGCTTGAG. External right primer: GGGGTACTGTGGCTGAAAAA. Internal left primer: TAAATCAAACGCCCTTGGAA. Internal right primer: AAACGAAAACCCGGAGAAAT. Internal WT amplicon: 2970 bp. Deletion size: 1921 bp. Deletion left flank: TGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCT AGGATCTGGGGTAGGCCTAGGATC. Deletion right flank: GAAATACGGCGTACACACACGATATTCACG. Validation: ok287 passed by CGH. Other deletions (gkDf56 and gk3558) identified by CGH."|"This strain is homozygous for a deletion (ok287) in K07A9.2, detectable by PCR using the following primers. External left primer: CAGTGCCTTTAGGGCTTGAG. External right primer: GGGGTACTGTGGCTGAAAAA. Internal left primer: TAAATCAAACGCCCTTGGAA. Internal right primer: AAACGAAAACCCGGAGAAAT. Internal WT amplicon: 2970 bp. Deletion size: 1921 bp. Deletion left flank: TGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCTAGGATC. Deletion right flank: GAAATACGGCGTACACACACGATATTCACG. Validation: ok287 passed by CGH. Other deletions (gkDf56 and gk3558) identified by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035593 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00035519

Source Database: WormBase (WB)
Affected Genes: WBGene00006876(vab-10)
Genomic Alteration: WBGene00006876(vab-10)
Availability: available
Source References: PMID:38177158, PMID:38302462
Synonyms: vab-10(gk45) I.
Alternate IDs: WB-STRAIN:VC117, CGC_VC117
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK1151.1a. Superficially wild type."

Proper citation: RRID:WB-STRAIN:WBStrain00035519 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00035598

Source Database: WormBase (WB)
Affected Genes: WBGene00002048(ida-1)
Genomic Alteration: WBGene00002048(ida-1)
Availability: available
Source References: EMPTY
Synonyms: ida-1(ok409) III.
Alternate IDs: WB-STRAIN:VC226, CGC_VC226
Notes: B0244.2. Slow-growing, and some animals appear sterile or Egl. Tail defects are common, and hermaphrodites can be mistaken for males in extreme cases.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035598 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00035602

Source Database: WormBase (WB)
Affected Genes: WBGene00001687(gpn-1)
Genomic Alteration: WBGene00001687(gpn-1)
Availability: available
Source References: PMID:38177158
Synonyms: gpn-1(ok377) X.
Alternate IDs: WB-STRAIN:VC233, CGC_VC233
Notes: F59D12.4. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035602 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00035605

Source Database: WormBase (WB)
Affected Genes: WBGene00001309(emr-1)
Genomic Alteration: WBGene00001309(emr-1)
Availability: available
Source References: EMPTY
Synonyms: emr-1(gk119) I.
Alternate IDs: WB-STRAIN:VC237, CGC_VC237
Notes: M01D7.6. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035605 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00035687

Source Database: WormBase (WB)
Affected Genes: WBGene00002043(hyl-1)
Genomic Alteration: WBGene00002043(hyl-1)
Availability: available
Source References: EMPTY
Synonyms: hyl-1(gk203) IV.
Alternate IDs: WB-STRAIN:VC334, CGC_VC334
Notes: C09G4.1. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035687 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00035616

Source Database: WormBase (WB)
Affected Genes: WBGene00000373(cyp-14A5)
Genomic Alteration: WBGene00000373(cyp-14A5)
Availability: available
Source References: EMPTY
Synonyms: cyp-14A5(gk152) V.
Alternate IDs: WB-STRAIN:VC249, CGC_VC249
Notes: F08F3.7. Superficially wild type, mildly Him, some progeny sterile.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035616 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00035694

Source Database: WormBase (WB)
Affected Genes: WBGene00006448(glod-4)
Genomic Alteration: WBGene00006448(glod-4)
Availability: available
Source References: PMID:37728328
Synonyms: glod-4(gk189) III.
Alternate IDs: WB-STRAIN:VC343, CGC_VC343
Notes: C16C10.10. Superficially wild type.|"Mutagen:UV/TMP"|"Supplementary_genotype glod-4(gk189)"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035694 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00035695

Source Database: WormBase (WB)
Affected Genes: WBGene00004789(sgk-1)
Genomic Alteration: WBGene00004789(sgk-1)
Availability: available
Source References: EMPTY
Synonyms: sgk-1(ok538) X.
Alternate IDs: WB-STRAIN:VC345, CGC_VC345
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"W10G6.2. Superficially wild type."|"WBStrain provided so WBPaper00061869 paper added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00035695 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00035667

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00004271(rab-7)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00004271(rab-7)
Availability: available
Source References: EMPTY
Synonyms: rab-7(ok511)/mIn1 [mIs14 dpy-10(e128)] II.
Alternate IDs: WB-STRAIN:VC308, CGC_VC308
Notes: Made_by: Anna Rankin|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"W03C9.3. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and non-GFP ok511 homozygotes (Dpy animals that lay dead eggs). Pick WT and check for correct segregation of progeny to maintain."

Proper citation: RRID:WB-STRAIN:WBStrain00035667 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00035681

Source Database: WormBase (WB)
Affected Genes: WBGene00001513(gad-1)
Genomic Alteration: WBGene00001513(gad-1)
Availability: available
Source References: PMID:33713117
Synonyms: +/nT1 IV; gad-1(ok573)/nT1 V.
Alternate IDs: WB-STRAIN:VC327, CGC_VC327
Notes: Mutagen:UV/TMP|"T05H4.14. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous ok573 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035681 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00035659

Source Database: WormBase (WB)
Affected Genes: WBGene00006999(zyx-1)
Genomic Alteration: WBGene00006999(zyx-1)
Availability: available
Source References: PMID:37713439, PMID:37712432
Synonyms: zyx-1(gk190) II.
Alternate IDs: WB-STRAIN:VC299, CGC_VC299
Notes: F42G4.3b. Superficially wild type.|"Mutagen:UV/TMP"|"Supplementary_genotype zyx-1(gk190) II"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035659 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00035625

Source Database: WormBase (WB)
Affected Genes: WBGene00002124(inx-2)
Genomic Alteration: WBGene00002124(inx-2)
Availability: available
Source References: EMPTY
Synonyms: inx-2(ok376) X.
Alternate IDs: WB-STRAIN:VC260, CGC_VC260
Notes: F08G12.10. Superficially wild type.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035625 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00030287

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(tm4063) III; wgIs509.
Alternate IDs: WB-STRAIN:OP509, CGC_OP509
Notes: Made_by: DKV/RJT/PW|"Modern strain"|"wgIs509 [ets-4::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (URL: www.modencode.org)"

Proper citation: RRID:WB-STRAIN:WBStrain00030287 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00030313

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(tm4063) III; wgIs536.
Alternate IDs: WB-STRAIN:OP536, CGC_OP536
Notes: Generated from Paper data WBPaper00060123|"Made_by: DKV/RJT/PW"|"Modern strain"|"wgIs536 [irx-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (URL: www.modencode.org)."

Proper citation: RRID:WB-STRAIN:WBStrain00030313 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00030387

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(tm4063) III; wgIs639.
Alternate IDs: WB-STRAIN:OP639, CGC_OP639
Notes: Made_by: DKV/RJT/PW|"Modern strain"|"wgIs639 [ham-2::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (URL: www.modencode.org)."

Proper citation: RRID:WB-STRAIN:WBStrain00030387 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00030334

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(tm4063) III; wgIs563.
Alternate IDs: WB-STRAIN:OP563, CGC_OP563
Notes: Made_by: DKV/RJT/PW|"Modern strain"|"wgIs563 [cebp-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (URL: www.modencode.org)."

Proper citation: RRID:WB-STRAIN:WBStrain00030334 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00030557

Source Database: WormBase (WB)
Availability: available
Source References: PMID:37878696
Synonyms: ccTi1594 umnIs7 III.
Alternate IDs: WB-STRAIN:PD2218, CGC_PD2218
Notes: ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. umnIs7 [myo-2p::GFP + NeoR, III:9421936] III. GFP expression in germline and GFP expression in pharynx. High penetrance of non-Mendelian inheritance. Neomycin resistant. The GPR-1 overexpression transgene consistently confers a high penetrance of non-Mendelian inheritance; fluorescent markers allow tracking of Mendelian and non-Mendelian events. The genomic location of ccTi1594 is with respect to the WEBcel235 assembly.|"Supplementary_genotype ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. umnIs7 [myo-2p::GFP + NeoR, III:9421936] III"

Proper citation: RRID:WB-STRAIN:WBStrain00030557 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00030555

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: ccTi1594 unc-119(ed3) III.
Alternate IDs: WB-STRAIN:PD1594, CGC_PD1594
Notes: ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. GFP expression in germline. Transgene rescues unc-119(ed3). Improved GPR-1 over-expression transgene appears to be stably expressed in the germline at a wide range of temperatures and does not require special handling. (unlike other GPR-1 overexpressing transgenes previously described in the literature). The GPR-1 overexpression transgene consistently confers a high penetrance of non-Mendelian inheritance. Neomycin resistant. The genomic location of ccTi1594 is with respect to the WEBcel235 assembly.|"Made_by: Christian Froekjaer Jensen"

Proper citation: RRID:WB-STRAIN:WBStrain00030555 Copy   

•   Source: Integrated Animals