Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401938653
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2025-03-31)
Alternate IDs: 401938653
Notes: The Ctns gen was deleted by oocyte injection of the CRISPER/Cas9 system (PolyGene AG, Zurich,Switzer-land). Two single guideRNAs(sgRNAs) targeting exon3 of Ctns were selected :CRISPR1a: ACCAACGTCAGCATTAC-CCT(TGG), CRISPR1b: CCATTTACCAGCTTCACAGT(GGG). This Ctns rat line harboring a deletion of 12bp and insertion of 8bp resultingin a premature stop codon in the exon3 of Ctns. Contact Olivier Devuyst at Email: [email protected], National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_401938653 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=329955459
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 329955459
Notes: A global P2RX7KO on a WKYbackground was created at Imperial College London using zinc finger nuclease
(ZFN) technology to generate a 2 base pair insertion in exon 10 of P2rx7
Proper citation: RRID:RGD_329955459 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139876
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Genomic Alteration: (null)
Availability: Extinct (as of 2017-01-26)
Source References: (null)
Alternate IDs: 4139876
Notes: This strain was produced by injecting ZFNs targeting the sequence aaccacaaccaactacgatgatgaccggaagtggggc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 7.
Proper citation: RRID:RGD_4139876 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=405850241
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 405850241
Notes: Sprague Dawley rats by microinjection of TALENs in fertilized eggs (Cyagen Biosciences). Briefly, the rno-mir-500 gene (Gene ID: 100314112; MirBase accession no. MIMAT0005321), which was located on rat chromosome X, was selected as the TALEN target site. TALENs were constructed using the Golden Gate Assembly and confirmed by sequencing. The founder, which carried 8- bp deletion (GCACCTGG) in the both strands compared with the wild-type (WT) DNA sequence, were genotyped by PCR followed by DNA-sequencing analysis. After that, heterozygous F1 were produced by mating F0 with WT rats. Heterozygous F1 rats were determined and mated to produce homozygote mutant (mir-500−/−) and WT (mir-500+/+).
Proper citation: RRID:RGD_405850241 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401827145
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryorecovery (as of 2025-01-27)
Alternate IDs: 401827145
Notes: The CRISPR-Cas9 system was used to delete the coding region (exons 1-8) of the Pink1 gene in NTac:SD embryos. The rat is deposited at Rat Resource and Research Center (RRRC).
Rat Resource and Research Center
Proper citation: RRID:RGD_401827145 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=329845599
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 329845599
Notes: Genome editing was performed using the rGONAD method to produce three different lines of KO rats due to three different genome mutations thus different in protein expression predication. The genetic background is WKY/NCrlCrlj (Charles River Laboratories Japan) (RGD:61119). Tandem STOP codons were designed to integrate into 27 bases after the first ATG in the rat Col4a5 gene This em2 mutant carries a premature stop coden after 15 amino acids due to insertion of a 42bp stop codon. Col4α5 em2 rats have urinary protein and hematuria from early on, and males begin to die at 18 weeks of age and all die by 28 weeks of age. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_329845599 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401940198
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 401940198
Notes: The Ahr wild type littermates from the cross of heterozygous Ahr rats. The Ahr mutants were created using CRISPR/Cas9 gene editing to delete a portion of exon 2 of Ahr in Sprague Dawley rats .
Proper citation: RRID:RGD_401940198 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=329845597
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo (as of 2023-05-30)
Alternate IDs: 329845597
Notes: Genome editing was performed using the rGONAD method to produce three different lines of KO rats due to three different genome mutations thus different in protein expression predication. The genetic background is WKY/NCrlCrlj (Charles River Laboratories Japan) (RGD:61119). Tandem STOP codons were designed to integrate into 27 bases after the first ATG in the rat Col4a5 gene This em1 mutant carries a premature stop coden after 9 amino acids due to the insertion of a 20 bp stop codon. Col4a5 KO rats have urinary protein and hematuria from early on, and males begin to die at 18 weeks of age and all die by 28 weeks of age. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_329845597 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155630631
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 155630631
Notes: The mutant rat was produced by injecting Crl:CD(SD) zygotes with gRNA +Cas9 ribonucleoprotein complex targeting exon 3 of rat Ctns. The founder of this strain possessed a 2-bp insertion which results in frameshift and pre-mature stop truncated protein.
Proper citation: RRID:RGD_155630631 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=405649860
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 405649860
Notes: Two target sequences (GCCGTGTTCAACTACCCCGAGGG and
GCTGCGCAAGTGTTACGAAGTGG) within the second and third exon, respectively, of the
coding sequence of Esr1 (the rat gene encoding ERα) were selected. gRNAs targeting these
sequences were synthesized via in vitro transcription. gRNAs (25 ng/ul each) were co-
microinjected with Cas9 protein (40 ng/ul) into Sprague-Dawley rat embryos, and embryos were
transferred into pseudo-pregnant recipients. Animals heterozygous for a 25 base pair deletion in Esr1 exon 3 were used to establish an ER alpha mutant colony and subsequent homozygous mutant offspring were obtained for study. Department of Medicine, Division of Pulmonary, Critical Care, Sleep and Occupational Medicine, Indiana University School of Medicine, Indianapolis, Indiana, USA.
Proper citation: RRID:RGD_405649860 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=329845586
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2023-12-28)
Alternate IDs: 329845586
Notes: Izumo1 KO strain was established by CRISPR/Cas9 system using inbred WIAR (RGD:2304222) (SLC, Inc.). sgRNA:GGTGGCTGCAATAAAGACTT, PAM sequence:TGG. A 7-bp deletion(CTTTGGA)after start codon (Met) in exon2 of Izumo1 gene was detected. After establishment of WIAR background KO rats, this strain was mated with Slc:Wistar (RGD:2314928), hence this mutant is in mix background.Izumo1-deficient male rats are infertile. In female rats, no specific phenotype is observed. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_329845586 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=329955557
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2023-07-17)
Alternate IDs: 329955557
Notes: CRISPR/Cas9 knock-in of the human ACE2 transgene into the endogenous locus of the rat Ace2 gene. Single integration of hACE2, with expression driven by the endogenous rat Ace2 promoter. Provides a more natural expression pattern (versus abundant overexpression as seen in prior models). Deposited this strain with the Rat Resource and Research Center: (RRRC), 4011 Discovery Drive, Columbia, MO 65201. Phone: (573) 884-6076 Fax: 573-882-9857
Proper citation: RRID:RGD_329955557 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=405849411
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 405849411
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Krtcap3 gene of WKY/Ncrlrat embryos. This is the wild type littermate (from heterozygous breeders) carrying wild type Krtcap3. This wild type mutant usually is used as an experimental control. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_405849411 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5688030
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Genomic Alteration: (null)
Availability: Unknown
Source References: (null)
Alternate IDs: 5688030
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5688030 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=329969885
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 329969885
Notes: The conditional Trim44 knockout (Trim44 cKO, SD-Trim44em1Lizh, RGD:329969883) was bred with the α-MHC-Cre tool rat (SD-Tg(Myh6-cre)Lizh, RGD:329969882) to generate cardiac-specific Trim44 knockout which had the Trim44flox/flox/α-MHC-Cre genotype.
Proper citation: RRID:RGD_329969885 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401795481
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-09-11)
Alternate IDs: 401795481
Notes: The targeting vector was designed to replace the stop codon of Nanos3 with T2A-2xtdTomato. The adeno-associated virus carrying the targeting vector was infected to Crlj:WI (RGD ID: 2312504) rat 1 cell zygotes followed by the introduction of CRISPR/Cas9 ribonucleoprotein complex by electroporation. After incubation overnight, the zygotes were transferred into oviducts of pseudo-pregnant rats. The pups were judged correct gene-targeting by genomic PCR. These rat strains are being maintained by crossing the founder rats with Crlj:WI rats. The tdTomato fluorescence faithfully label Nanos3 expressing cells. Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi 444-8787, Japan. or Division of Mammalian Embryology, Center for Stem Cell Biology and Regenerative Medicine, The Institute for Medical Science, The University of Tokyo, Tokyo108-8639, Japan.
Proper citation: RRID:RGD_401795481 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092575
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo (as of 2025-03-27)
Alternate IDs: 598092575
Notes: This strain, called KK rats, in homozygous rats show gait abnormalities from around 5-6 weeks of age. Thereafter, the neurological symptoms progress rapidly, leading to emaciation and death. The mutant gene was named kk, as Kenta Kumafuji was the discoverer of the gait abnormality. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_598092575 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092509
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryopreserved Sperm (as of 2025-03-21)
Alternate IDs: 598092509
Notes: Gal-3 KO rats were developed using CRISPR technology on the Sprague-Dawley background (Sage). CRISPR guides were selected targeting the fifth exon, and gene disruption was confirmed by genomic sequencing and immunoblot analysis for Gal-3 protein expression in lung tissue. PMCID: PMC6589585 Availability Contact Email: [email protected] at Augusta University
Proper citation: RRID:RGD_598092509 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092583
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-27)
Alternate IDs: 598092583
Notes: Cre was inserted at the start codon (methionine) of the somatostatin (Sst) gene. The Sst precursor is then expressed using the T2A peptide as a linker. Genetic background is Iar:Long-Evans (Institute for Animal Reproduction). National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_598092583 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092585
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-27)
Alternate IDs: 598092585
Notes: The ES cell line derived from Lister Hooded rats (Seac:LIS), which was established by Prof. Sakimura at Department of Animal Model Development, Brain Research Institute, Niigata University, was used. Cloned ES cells established by introducing a vector of G8CaMP-flox stop at the 3'non-coding site of the Actb gene were injected into fertilized eggs of SD rats (Slc:SD) using a microinjection method. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_598092585 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.