Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi-Il1r1em2Mcwi Resource Report Resource Website |
RRID:RGD_6893443 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence AGCTTCATACAGCGGCtccatgTTGCAGGGGATGGAAGTC into BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi rat embryos. The resulting mutation is a 7-bp deletin in exon 5. | 6893443 | mutant | Rat Genome Database (RGD) | RGD | Extinct | 6893443 | 2026-09-19 01:18:39 | 0 | |||||
|
SS-Kcnmb1em3Mcwi Resource Report Resource Website |
RRID:RGD_6893444 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence AGCTGCATCATAAACACCttcatcATTGGGGCAGCCTTGGCA into SS/JrHsdMcwi rat embryos. The resulting allele is a 21-bp deletion in exon 2 and intron 2. | 6893444 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 6893444 | 2026-09-19 01:18:39 | 0 | |||||
|
SS-Grm7em2Mcwi Resource Report Resource Website |
RRID:RGD_6893441 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence ATCCGCCATGTTAACTTCaatggTAAGACTCCAATGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in exon 3. | 6893441 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 6893441 | 2026-09-19 01:18:39 | 0 | |||||
|
SS-Ppargem1Mcwi Resource Report Resource Website |
RRID:RGD_6893442 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence TGCCATTCTGGCCCAccaactTCGGAATCAGCTCTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a a 133-bp deletion of (RGSC 5.0/rn5): chr4:210,640,676-210,640,808, including part of intron 1 and exon 2 of isoform NM_013124.3 | 6893442 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 6893442 | 2026-09-19 01:18:39 | 0 | |||||
|
SD-Nfe2l2em1Mcwi Resource Report Resource Website |
RRID:RGD_9588552 | Rattus norvegicus | This strain was produced by injecting TALENs targeting the sequence TAGTCCTGGCGGTGGCAATTCCAAGTCCATCATGCTGAGGGCGGACGCTGCGCTA into Crl:SD Sprague Dawley rat embryos. The resulting mutation is a 41-bp deletion in exon 1. | 9588552 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2017-01-26) | 9588552 | 2026-09-19 01:18:40 | 0 | |||||
|
LE-Lrrk2em1Sage Resource Report Resource Website |
RRID:RGD_7241050 | Rattus norvegicus | This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 30. Horizon Discovery | 7241050 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2017-06-06) | 7241050 | 2026-09-19 01:18:41 | 0 | |||||
|
SHR-Ndufc2em1Mcwi Resource Report Resource Website |
RRID:RGD_9588544 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence GGCTTCCTGGGCTACTGCacgggcCTGATGGACAACATG into SHR/NCrl rat embryos. The resulting mutation is a 9-bp deletion in exon 1. | 9588544 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 9588544 | 2026-09-19 01:18:40 | 0 | |||||
|
SHR-Ndufc2em2Mcwi Resource Report Resource Website |
RRID:RGD_9588546 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence GGCTTCCTGGGCTACTGCacgggcCTGATGGACAACATG into SHR/NCrl rat embryos. The resulting mutation is a net 107-bp deltion in exon 1. | 9588546 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 9588546 | 2026-09-19 01:18:40 | 0 | |||||
|
F344-Il2rgem1Kyo Resource Report Resource Website 1+ mentions |
RRID:RGD_9685625 | Rattus norvegicus | The strain having a zinc finger nuclease-induced 660-bp deletion mutation in Il2rg gene shows severe combined immunodeficiency and grows normally under SPF condition. National BioResource Project for the Rat in Japan | 9685625 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-03-27) | 9685625 | 2026-09-19 01:18:40 | 1 | |||||
|
LEW-Rag1em1Ztm Resource Report Resource Website |
RRID:RGD_7204133 | Rattus norvegicus | This strain was produced by injecting ZFNs into LEW/Ztm rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 2. | 7204133 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 7204133 | 2026-09-19 01:18:40 | 0 | |||||
|
SD-Pax6Sey2/Mce Resource Report Resource Website |
RRID:RGD_9685623 | Rattus norvegicus | This rat (developed spontaneous microphthalmia) was found in a SD rat colony at Yamanouchi Pharma Inc. (Astellas Pharma Inc.)Genomic DNA analysis from mutants revealed a single base(c) insertion, resulting in a abnormal stop codon at 33-bp downstream from the insertion site due to frameshift. National BioResource Project for the Rat in Japan | 9685623 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-02-23) | 9685623 | 2026-09-19 01:18:40 | 0 | |||||
|
F344-Il2rgem7Kyo Resource Report Resource Website |
RRID:RGD_8552331 | Rattus norvegicus | The strain having a Endonuclease-induced 7 bp deletion mutation in the 2nd exon of the rat Il2rg gene was established by TAL effector nuclease obtained from Dr. Yamamoto at Hiroshima University. National BioResource Project for the Rat in Japan | 8552331 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 8552331 | 2026-09-19 01:18:40 | 0 | |||||
|
KHR/Kyo-/+ Resource Report Resource Website |
RRID:RGD_7800705 | Rattus norvegicus | Kaken hairless rat were detected by Kimura from Gunn's rat at Kaken Pharmaceuticals in 1987. 2002 introduced to Kyoto University (F36). National BioResource Project for the Rat in Japan | 7800705 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo; Cryopreserved Sperm | 7800705 | 2026-09-19 01:18:40 | 0 | |||||
|
F344-Lepm1Kyo Resource Report Resource Website |
RRID:RGD_8549776 | Rattus norvegicus | Established by ENU mutagenesis in F344/NSlc rats. This strain has Lep missense mutation (Q92X). National BioResource Project for the Rat in Japan | 8549776 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2017-03-17) | 8549776 | 2026-09-19 01:18:41 | 0 | |||||
|
LE-Lrrk1em1Sage-/- Resource Report Resource Website |
RRID:RGD_7241057 | Rattus norvegicus | ZFN mutant founders carrying a 19-bp frameshift deletion in exon 4 were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous. Horizon Discovery | 7241057 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 7241057 | 2026-09-19 01:18:41 | 0 | |||||
|
LE-Lrrk2em1Sage-/- Resource Report Resource Website 1+ mentions |
RRID:RGD_7241056 | Rattus norvegicus | ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offspring which were intercrossed and offsprings maintained as homozygous Sigma Advanced Genetic Engineering Labs | 7241056 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2018-08-24) | 7241056 | 2026-09-19 01:18:41 | 1 | |||||
|
LE-Pink1em1Sage Resource Report Resource Website |
RRID:RGD_7241054 | Rattus norvegicus | This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 26-bp frameshift deletion in exon 4. Sigma Advanced Genetic Engineering Labs | 7241054 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 7241054 | 2026-09-19 01:18:41 | 0 | |||||
|
F344.Cg-Du, TyrCKyo+/+ Resource Report Resource Website |
RRID:RGD_7800661 | Rattus norvegicus | Developed by the DEPOSITOR National BioResource Project for the Rat in Japan | 7800661 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 7800661 | 2026-09-19 01:18:42 | 0 | |||||
|
F344-Il2rgem3Kyo Resource Report Resource Website |
RRID:RGD_9685750 | Rattus norvegicus | This strain shows severe combined immunodeficiency caused by a 332 bp deletion in Il2rg gene and grow normally under SPF condition. National BioResource Project for the Rat in Japan | 9685750 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 9685750 | 2026-09-19 01:18:41 | 0 | |||||
|
DA-Tyrem2Kyo Resource Report Resource Website |
RRID:RGD_8552303 | Rattus norvegicus | Developed by the DEPOSITOR National BioResource Project for the Rat in Japan | 8552303 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Sperm | 8552303 | 2026-09-19 01:18:42 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.