Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6893443
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 6893443
Notes: This strain was produced by injecting ZFNs targeting the sequence AGCTTCATACAGCGGCtccatgTTGCAGGGGATGGAAGTC into BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi rat embryos. The resulting mutation is a 7-bp deletin in exon 5.
Proper citation: RRID:RGD_6893443 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6893444
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 6893444
Notes: This strain was produced by injecting ZFNs targeting the sequence AGCTGCATCATAAACACCttcatcATTGGGGCAGCCTTGGCA into SS/JrHsdMcwi rat embryos. The resulting allele is a 21-bp deletion in exon 2 and intron 2.
Proper citation: RRID:RGD_6893444 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6893441
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 6893441
Notes: This strain was produced by injecting ZFNs targeting the sequence ATCCGCCATGTTAACTTCaatggTAAGACTCCAATGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in exon 3.
Proper citation: RRID:RGD_6893441 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6893442
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 6893442
Notes: This strain was produced by injecting ZFNs targeting the sequence TGCCATTCTGGCCCAccaactTCGGAATCAGCTCTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a a 133-bp deletion of (RGSC 5.0/rn5): chr4:210,640,676-210,640,808, including part of intron 1 and exon 2 of isoform NM_013124.3
Proper citation: RRID:RGD_6893442 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=9588552
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2017-01-26)
Alternate IDs: 9588552
Notes: This strain was produced by injecting TALENs targeting the sequence TAGTCCTGGCGGTGGCAATTCCAAGTCCATCATGCTGAGGGCGGACGCTGCGCTA into Crl:SD Sprague Dawley rat embryos. The resulting mutation is a 41-bp deletion in exon 1.
Proper citation: RRID:RGD_9588552 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7241050
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2017-06-06)
Alternate IDs: 7241050
Notes: This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 30. Horizon Discovery
Proper citation: RRID:RGD_7241050 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=9588544
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 9588544
Notes: This strain was produced by injecting ZFNs targeting the sequence GGCTTCCTGGGCTACTGCacgggcCTGATGGACAACATG into SHR/NCrl rat embryos. The resulting mutation is a 9-bp deletion in exon 1.
Proper citation: RRID:RGD_9588544 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=9588546
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 9588546
Notes: This strain was produced by injecting ZFNs targeting the sequence GGCTTCCTGGGCTACTGCacgggcCTGATGGACAACATG into SHR/NCrl rat embryos. The resulting mutation is a net 107-bp deltion in exon 1.
Proper citation: RRID:RGD_9588546 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=9685625
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-03-27)
Alternate IDs: 9685625
Notes: The strain having a zinc finger nuclease-induced 660-bp deletion mutation in Il2rg gene shows severe combined immunodeficiency and grows normally under SPF condition. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_9685625 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7204133
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 7204133
Notes: This strain was produced by injecting ZFNs into LEW/Ztm rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 2.
Proper citation: RRID:RGD_7204133 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=9685623
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-02-23)
Alternate IDs: 9685623
Notes: This rat (developed spontaneous microphthalmia) was found in a SD rat colony at Yamanouchi Pharma Inc. (Astellas Pharma Inc.)Genomic DNA analysis from mutants revealed a single base(c) insertion, resulting in a abnormal stop codon at 33-bp downstream from the insertion site due to frameshift. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_9685623 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=8552331
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 8552331
Notes: The strain having a Endonuclease-induced 7 bp deletion mutation in the 2nd exon of the rat Il2rg gene was established by TAL effector nuclease obtained from Dr. Yamamoto at Hiroshima University. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_8552331 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7800705
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo; Cryopreserved Sperm
Alternate IDs: 7800705
Notes: Kaken hairless rat were detected by Kimura from Gunn's rat at Kaken Pharmaceuticals in 1987. 2002 introduced to Kyoto University (F36). National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_7800705 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=8549776
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2017-03-17)
Alternate IDs: 8549776
Notes: Established by ENU mutagenesis in F344/NSlc rats. This strain has Lep missense mutation (Q92X). National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_8549776 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7241057
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 7241057
Notes: ZFN mutant founders carrying a 19-bp frameshift deletion in exon 4 were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous. Horizon Discovery
Proper citation: RRID:RGD_7241057 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7241056
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2018-08-24)
Alternate IDs: 7241056
Notes: ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offspring which were intercrossed and offsprings maintained as homozygous Sigma Advanced Genetic Engineering Labs
Proper citation: RRID:RGD_7241056 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7241054
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 7241054
Notes: This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 26-bp frameshift deletion in exon 4. Sigma Advanced Genetic Engineering Labs
Proper citation: RRID:RGD_7241054 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7800661
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 7800661
Notes: Developed by the DEPOSITOR National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_7800661 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=9685750
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 9685750
Notes: This strain shows severe combined immunodeficiency caused by a 332 bp deletion in Il2rg gene and grow normally under SPF condition. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_9685750 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=8552303
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryopreserved Sperm
Alternate IDs: 8552303
Notes: Developed by the DEPOSITOR National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_8552303 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.