Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00049440
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: +/nT1[umnIs49] IV; ZK856.11(ve701[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V.
Notes: Made_by: RG KO Group|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Mid-larval arrest, arrested larvae are somewhat Dpy. Deletion of 980 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested somewhat Dpy larvae (ve701 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aggcagcaggcgcataaacaggaaagtaaa ; Right flanking sequence: tcaggtttaaaaaaaattgagttttaagtt. sgRNA #1: cataaacaggaaagtaaagg; sgRNA #2: GTAGCAGCAGACATgatttc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."
Proper citation: RRID:WB-STRAIN:WBStrain00049440 Copy
http://www.wormbase.org/db/get?name=WBStrain00049438
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: ZK792.5(ve699[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V.
Notes: Made_by: RG KO Group|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous sterile. Deletion of 3088 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate sterile adults (ve699 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ccctttttgtttgccaagattatcagatga ; Right flanking sequence: TGTGGCTTCTTCTCAGCATCAGCAGCAGCA. sgRNA #1: gccaagattatcagatgatc; sgRNA #2: AAATTGTTTCTCTCCTCCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."
Proper citation: RRID:WB-STRAIN:WBStrain00049438 Copy
http://www.wormbase.org/db/get?name=WBStrain00049471
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006787(unc-52)|WBGene00006789(unc-54)|WBGene00012896(snrp-200)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006787(unc-52), WBGene00006789(unc-54), WBGene00012896(snrp-200)
Availability: unknown
Source References: EMPTY
Synonyms: snrp-200(ve734[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II.
Notes: Made_by: RG KO Group|"umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval lethal. Deletion of 9661 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead larvae (ve734 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ttgaaaagaataataataataatacaaata ; Right flanking sequence: aggttaaaaaaatcaaaacaagaaataaaa. sgRNA #3: gaccagggagtgggtgacgg; sgRNA #4: GAATCCAGCAGTATGAGTAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."
Proper citation: RRID:WB-STRAIN:WBStrain00049471 Copy
http://www.wormbase.org/db/get?name=WBStrain00049472
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: Y39B6A.3(ve735[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ V.
Notes: Homozygous early larval arrest as an unbalanced heterozygote. Deletion of 852 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type dim GFP+, and segregate wild-type dim GFP+, bright GFP+arrested larvae (ve735 homozygotes) and non-GFP wild-type homozygotes. Maintain by picking wild-type dim GFP+.Left flanking Sequence: tttattagcattttttctagaatgtacacg ; Right flanking sequence: tttttttctgtaaattttttacgaaaatat. sgRNA #3: CGTCACCGATAAGCTATCGT; sgRNA #4: ggtaaactacacgcgtggcc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.Note: This allele cannot be balanced by sC4 because it is contained within a deleted region. See Maroilley et al. Sci Reports (2021)11:18258 for more details. doi.org/10.1038/s41598-021-97764-9|"Homozygous early larval arrest. Deletion of 852 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+arrested larvae (ve735 homozygotes) and arrested non-GFP (stage unknown) (sC4 homozygotes). Maintain by picking wild-type GFP+.Left flanking Sequence: tttattagcattttttctagaatgtacacg ; Right flanking sequence: tttttttctgtaaattttttacgaaaatat. sgRNA #3: CGTCACCGATAAGCTATCGT; sgRNA #4: ggtaaactacacgcgtggcc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00049472 Copy
http://www.wormbase.org/db/get?name=WBStrain00049469
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: gtf-2F2(ve732[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ V.
Notes: Homozygous sterile deletion as an unbalanced het. Deletion of 3148 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type dim GFP+, and segregate wild-type dim GFP+, bright GFP+adult sterile animals (ve732 homozygotes) and non-GFP wild-type homozygotes. Maintain by picking wild-type dim GFP+. Left flanking Sequence: GCAGGGACTCGGTGCAGATGCTCCAATCAA ; Right flanking sequence: tgggttatttagcccagttttctatttatt. sgRNA #3: AACTGGAAAACTGGCAATTG; sgRNA #4: AGGCACCACAGAGACTTGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.Note: This allele cannot be balanced by sC4 because it is contained within a deleted region. See Maroilley et al. Sci Reports (2021)11:18258 for more details. doi.org/10.1038/s41598-021-97764-9|"Homozygous sterile. Deletion of 3148 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+adult sterile animals (ve732 homozygotes) and arrested non-GFP (stage unknown) (sC4 homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: GCAGGGACTCGGTGCAGATGCTCCAATCAA ; Right flanking sequence: tgggttatttagcccagttttctatttatt. sgRNA #3: AACTGGAAAACTGGCAATTG; sgRNA #4: AGGCACCACAGAGACTTGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00049469 Copy
http://www.wormbase.org/db/get?name=WBStrain00022584
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00003983(pes-10)
Genomic Alteration: WBGene00003514(myo-2), WBGene00003983(pes-10)
Availability: available
Source References: EMPTY
Synonyms: qIs54 X.
Alternate IDs: WB-STRAIN:JK2735, CGC_JK2735
Notes: qIs54 [pes-10p::GFP + myo-2p::GFP + F22B7.9::GFP]. Superficially wild-type. GFP expression in pharynx, gut and early embryos. qIs54 males mate, but not as well as wild-type. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
Proper citation: RRID:WB-STRAIN:WBStrain00022584 Copy
http://www.wormbase.org/db/get?name=WBStrain00004651
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00003983(pes-10)|WBGene00017698(F22B7.9)
Genomic Alteration: WBGene00003514(myo-2), WBGene00003983(pes-10), WBGene00017698(F22B7.9)
Availability: available
Source References: PMID:37548405
Synonyms: mIs12 II.
Alternate IDs: WB-STRAIN:CB5584, CGC_CB5584
Notes: mIs12 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP] II. Hermaphrodites expressing compound GFP reporter (see PD4790). Strong pharyngeal muscle expression, easily scored by GFP dissecting scope. mIs12 is tightly linked to unc-4 II, and not to LG III or IV as previously reported. mIs12 homozygous males mate well (ME3).
Proper citation: RRID:WB-STRAIN:WBStrain00004651 Copy
http://www.wormbase.org/db/get?name=WBStrain00004991
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: F36D4.4(umn4[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
Alternate IDs: WB-STRAIN:CGC61, CGC_CGC61
Notes: Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATGTACTCCCCTATATCTTCCAAACATTC ; Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CATGTACTCCCCTATATCTTCCAAACATTC ; Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of F36D4.4. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: atgacaatgtctcaagggtccatgtactcccctatatcttccaaacattc Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCTCAATTTATTTGTCATTATTG"
Proper citation: RRID:WB-STRAIN:WBStrain00004991 Copy
http://www.wormbase.org/db/get?name=WBStrain00004989
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00008737(gnrr-7)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00008737(gnrr-7)
Availability: available
Source References: EMPTY
Synonyms: gnrr-7(umn3[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X.
Alternate IDs: WB-STRAIN:CGC59, CGC_CGC59
Notes: Homozygous viable. Deletion of 1004 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttgttctggtttaaagccgcaaagtcttgg ; Right flanking sequence: agggtaccatcaagcaatggcattctggtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1004 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ttgttctggtttaaagccgcaaagtcttgg ; Right flanking sequence: agggtaccatcaagcaatggcattctggtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of gnrr-7. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ATATTTATTTAATATATATTTTGTTCTGGTTTAAAGCCGCAAAGTCTTGG Right flanking sequence: AGGGTACCATCAAGCAATGGCATTCTGGTTGCCCTTAAGCATAACAATTG"
Proper citation: RRID:WB-STRAIN:WBStrain00004989 Copy
http://www.wormbase.org/db/get?name=WBStrain00004988
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: C54E10.3(umn2[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
Alternate IDs: WB-STRAIN:CGC58, CGC_CGC58
Notes: Homozygous viable. Deletion of 745 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tgtacccccgatgggattcgaacctgtggc ; Right flanking sequence: gggtatgcaaaatgaccgcgttttctgtga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 745 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtacccccgatgggattcgaacctgtggc ; Right flanking sequence: gggtatgcaaaatgaccgcgttttctgtga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of C54E10.3. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: tctccgcctaaaaaaatatatgtacccccgatgggattcgaacctgtggc Right flanking sequence: GGGTATGCAAAATGACCGCGTTTTCTGTGAATTCATCGTCATGCTTTATT"
Proper citation: RRID:WB-STRAIN:WBStrain00004988 Copy
http://www.wormbase.org/db/get?name=WBStrain00005002
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00021328(npr-23)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00021328(npr-23)
Availability: available
Source References: EMPTY
Synonyms: npr-23(umn5[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I.
Alternate IDs: WB-STRAIN:CGC72, CGC_CGC72
Notes: Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of npr-23. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: cccctgcctctggctcccacaaggcgtcatctggagagaagaacgaagtg Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGCGTTGCTCGTATTGGTGCCGG"
Proper citation: RRID:WB-STRAIN:WBStrain00005002 Copy
http://www.wormbase.org/db/get?name=WBStrain00005007
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: C04C3.6(umn8[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV.
Alternate IDs: WB-STRAIN:CGC78, CGC_CGC78
Notes: Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaatcaactatttttaatgaaaatttca ; Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: aaaaatcaactatttttaatgaaaatttca ; Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of C04C3.6. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ttgaaaatttgaaatttgaaaaaaatcaactatttttaatgaaaatttca Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGTTCATCGTGCTTCGAAAGTAC"
Proper citation: RRID:WB-STRAIN:WBStrain00005007 Copy
http://www.wormbase.org/db/get?name=WBStrain00005026
Source Database: WormBase (WB)
Affected Genes: WBGene00003289(mir-61)|WBGene00003514(myo-2)
Genomic Alteration: WBGene00003289(mir-61), WBGene00003514(myo-2)
Availability: available
Source References: EMPTY
Synonyms: mir-61(umn15[lox2272 myo-2p::wrmScarlet + lox511I + Lox2272]) V.
Alternate IDs: WB-STRAIN:CGC103, CGC_CGC103
Notes: Made_by: Julie Knott & Marcus Vargas|"mir-61(umn15[lox2272 myo-2p::wrmScarlet + lox511I + Lox2272]) V. Derived by CRE-meditated excision of SEC in parental strain CGC102, leaving myo-2p::wrmScarlet."
Proper citation: RRID:WB-STRAIN:WBStrain00005026 Copy
http://www.wormbase.org/db/get?name=WBStrain00005046
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004897(snb-1)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004897(snb-1)
Availability: unknown
Source References: PMID:21123567, PMID:39724103
Synonyms: [Psnb-1::TDP-43(A315T), Pmyo-2::dsRED]
Alternate IDs: WB-STRAIN:CK426
Notes: Psnb-1::TDP-43 (A315T)|"[2020-05-27T21:32:53.973Z WBPerson324] Ressurect Strain: WBPaper00037845, Genotype: [Psnb-1::TDP-43(A315T), Pmyo-2::dsRED]"|"[2020-05-27T21:32:53.973Z WBPerson324] Update Strain: WBPaper00037845, Genotype: [Psnb-1::TDP-43(A315T), Pmyo-2::dsRED]"
Proper citation: RRID:WB-STRAIN:WBStrain00005046 Copy
http://www.wormbase.org/db/get?name=WBStrain00005043
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004897(snb-1)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004897(snb-1)
Availability: unknown
Source References: PMID:21123567, PMID:29409526
Synonyms: [Psnb-1::TDP-43(+), Pmyo-2::dsRED]
Alternate IDs: WB-STRAIN:CK410
Notes: Psnb-1::TDP-43 (WT)|"[2020-05-27T21:05:07.59Z WBPerson324] Adding data Strain: WBPaper00037845, Genotype: [Psnb-1::TDP-43(+), Pmyo-2::dsRED] Description: expresses pan-neuronal human wild-type TDP-43 cDNA (NM_007375) and a Pmyo-2::dsRED coinjection marker, at a lower level"
Proper citation: RRID:WB-STRAIN:WBStrain00005043 Copy
http://www.wormbase.org/db/get?name=WBStrain00005044
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004897(snb-1)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004897(snb-1)
Availability: unknown
Source References: PMID:21123567, PMID:39724103
Synonyms: [Psnb-1::TDP-43(G290A), Pmyo-2::dsRED]
Alternate IDs: WB-STRAIN:CK422
Notes: Psnb-1::TDP-43 (G290A)|"[2020-05-27T21:29:50.154Z WBPerson324] Adding data Strain: WBPaper00037845, Genotype: [Psnb-1::TDP-43(G290A), Pmyo-2::dsRED]"
Proper citation: RRID:WB-STRAIN:WBStrain00005044 Copy
http://www.wormbase.org/db/get?name=WBStrain00005042
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004897(snb-1)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004897(snb-1)
Availability: unknown
Source References: PMID:21123567
Synonyms: [Psnb-1::TDP-43(+), Pmyo-2::dsRED]
Alternate IDs: WB-STRAIN:CK405
Notes: Psnb-1::TDP-43 (WT)|"[2020-05-27T21:00:18.108Z WBPerson324] Adding data Strain: WBPaper00037845, Genotype: [Psnb-1::TDP-43(+), Pmyo-2::dsRED] Description: expresses pan-neuronal human wild-type TDP-43 cDNA (NM_007375) and a Pmyo-2::dsRED coinjection marker."
Proper citation: RRID:WB-STRAIN:WBStrain00005042 Copy
http://www.wormbase.org/db/get?name=WBStrain00005589
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)
Genomic Alteration: WBGene00003514(myo-2)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:DA2038
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00005589 Copy
http://www.wormbase.org/db/get?name=WBStrain00007980
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00003514(myo-2), WBGene00006843(unc-119)
Availability: available
Source References: PMID:32088829, PMID:37080524, PMID:37838776, PMID:39149885, PMID:39329779
Synonyms: gnaIs2 [myo-2p::YFP + unc-119p::Abeta1-42]
Alternate IDs: WB-STRAIN:GRU102, CGC_GRU102
Notes: gnaIs2 [myo-2p::YFP + unc-119p::Abeta1-42]. Pan-neuronal amyloid beta1-42 expression. Impaired neuromuscular and sensorimotor behavior. See GRU101 for wild-type control strain. Reference: Fong S, et al. Sci Rep. 2016 Sep 22;6:33781. doi: 10.1038/srep33781.|"Supplementary_genotype gnaIs2 [myo-2p::YFP + unc-119p::Abeta1-42],"|[2020-10-08T19:09:27.569Z WBPerson324] Ressurect Strain: Genotype: gnaIs2 [myo-2p::YFP + unc-119p::humanAbeta1-42]|[2020-10-08T23:35:51.358Z WBPerson324] Ressurect Strain: Genotype: gnaIs2 [myo-2p::YFP + unc-119p::Abeta1-42]
Proper citation: RRID:WB-STRAIN:WBStrain00007980 Copy
http://www.wormbase.org/db/get?name=WBStrain00007979
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)
Genomic Alteration: WBGene00003514(myo-2)
Availability: available
Source References: PMID:32088829, PMID:37080524, PMID:37838776, PMID:39329779, PMID:39572679
Synonyms: gnaIs1.
Alternate IDs: WB-STRAIN:GRU101, CGC_GRU101
Notes: Control strain for pan-neuronal amyloid beta1-42 expressing strain GRU102. WT phenotype with pharyngeal YFP expression. Reference: Fong S, et al. Sci Rep. 2016 Sep 22;6:33781. doi: 10.1038/srep33781.|"gnaIs1 [myo-2p::yfp]. Control strain for pan-neuronal amyloid beta1-42 expressing strain GRU102. WT phenotype with pharyngeal YFP expression. Reference: Fong S, et al. Sci Rep. 2016 Sep 22;6:33781. doi: 10.1038/srep33781."|"Supplementary_genotype gnaIs1 [myo-2p::YFP],"
Proper citation: RRID:WB-STRAIN:WBStrain00007979 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
