Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 35 showing 681 ~ 700 out of 62,713 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00037922

http://www.wormbase.org/db/get?name=WBStrain00037922

Source Database: WormBase (WB)
Affected Genes: WBGene00000992(dhs-29)
Genomic Alteration: WBGene00000992(dhs-29)
Availability: available
Source References: EMPTY
Synonyms: dhs-29(gk5199) X.
Alternate IDs: WB-STRAIN:VC4120, CGC_VC4120
Notes: Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5199 mutation is C->T, flanking sequences AGCGACCGGCACACTTGAAGAGAGCAGAAA and TGAAATAAAAAATTAGATTTTATCATGTTA.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00037922 Copy   


  • RRID:WB-STRAIN:WBStrain00037920

http://www.wormbase.org/db/get?name=WBStrain00037920

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006365(syg-1)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006365(syg-1), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: syg-1(gk5167[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X.
Alternate IDs: WB-STRAIN:VC4109, CGC_VC4109
Notes: Homozygous viable. Deletion of 2190 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGATTTTAAGAATACTTTCTTTTCCATAT ; Right flanking sequence: CACGGTTTCTTGAGAGATTTCTGGTTTTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00037920 Copy   


  • RRID:WB-STRAIN:WBStrain00037938

http://www.wormbase.org/db/get?name=WBStrain00037938

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004227(ptr-13)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004227(ptr-13), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: ptr-13(gk5246[loxP + myo-2::GFPp::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II.
Alternate IDs: WB-STRAIN:VC4160, CGC_VC4160
Notes: Homozygous viable. Deletion of 3626 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAACGGGTACGACGAACAATGGGGCCATGC ; Right flanking sequence: TGACGGCAGGCAGACAGGCAGAACATGTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00037938 Copy   


  • RRID:WB-STRAIN:WBStrain00029961

http://www.wormbase.org/db/get?name=WBStrain00029961

Source Database: WormBase (WB)
Affected Genes: WBGene00001086(dpy-27)
Genomic Alteration: WBGene00001086(dpy-27)
Availability: unknown
Source References: EMPTY
Synonyms: unc-119(ed3);wgIs31[WRM0626A_B12(pRedFlp-Hgr)::unc-119-Nat(dpy-27[34239]::2XTY1-eGFP(C.ele)-3XFLAG)dFRT]
Alternate IDs: WB-STRAIN:OP31
Notes: Imported directly from the transgeneOme database.

Proper citation: RRID:WB-STRAIN:WBStrain00029961 Copy   


  • RRID:WB-STRAIN:WBStrain00029960

http://www.wormbase.org/db/get?name=WBStrain00029960

Source Database: WormBase (WB)
Affected Genes: WBGene00003024(lin-39)
Genomic Alteration: WBGene00003024(lin-39)
Availability: unknown
Source References: EMPTY
Synonyms: unc-119(ed3);wgIs30[WRM0616A_E11(pRedFlp-Hgr)::unc-119-Nat(lin-39[36657]::2XTY1-eGFP(C.ele)-3XFLAG)dFRT]
Alternate IDs: WB-STRAIN:OP30
Notes: Imported directly from the transgeneOme database.

Proper citation: RRID:WB-STRAIN:WBStrain00029960 Copy   


  • RRID:WB-STRAIN:WBStrain00029959

http://www.wormbase.org/db/get?name=WBStrain00029959

Source Database: WormBase (WB)
Affected Genes: WBGene00000995(die-1)
Genomic Alteration: WBGene00000995(die-1)
Availability: unknown
Source References: EMPTY
Synonyms: unc-119(ed3);wgIs29[WRM0635C_B05(pRedFlp-Hgr)::unc-119-Nat(die-1[30547]::2XTY1-eGFP(C.ele)-3XFLAG)dFRT]
Alternate IDs: WB-STRAIN:OP29
Notes: Imported directly from the transgeneOme database.

Proper citation: RRID:WB-STRAIN:WBStrain00029959 Copy   


  • RRID:WB-STRAIN:WBStrain00029956

http://www.wormbase.org/db/get?name=WBStrain00029956

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; wgIs18.
Alternate IDs: WB-STRAIN:OP18, CGC_OP18
Notes: Generated from Paper data WBPaper00060123|"Made_by: modEncode"|"Modern strain"|"wgIs18 [lin-39::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of lin-39 coding sequence of fosmid ID#WRM0616aE11 by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (URL: www.modencode.org)"

Proper citation: RRID:WB-STRAIN:WBStrain00029956 Copy   


  • RRID:WB-STRAIN:WBStrain00029958

http://www.wormbase.org/db/get?name=WBStrain00029958

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; wgIs27.
Alternate IDs: WB-STRAIN:OP27, CGC_OP27
Notes: Generated from Paper data WBPaper00060123|"Made_by: modEncode"|"Modern strain"|"wgIs27 [mab-5::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of mab-5 coding sequence of fosmid ID#WRM0640bH09 by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (URL: www.modencode.org)"

Proper citation: RRID:WB-STRAIN:WBStrain00029958 Copy   


  • RRID:WB-STRAIN:WBStrain00029952

http://www.wormbase.org/db/get?name=WBStrain00029952

Source Database: WormBase (WB)
Affected Genes: WBGene00021132(nfyb-1)
Genomic Alteration: WBGene00021132(nfyb-1)
Availability: available
Source References: PMID:38302462
Synonyms: nfyb-1(cu13) II.
Alternate IDs: WB-STRAIN:OK814, CGC_OK814
Notes: Made_by: Addie Packard|"Superficially wild-type. Reference: Milton AC, et al. Dev Biol. 2013 Oct 1;382(1):38-47."

Proper citation: RRID:WB-STRAIN:WBStrain00029952 Copy   


  • RRID:WB-STRAIN:WBStrain00029948

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00029948

Source Database: WormBase (WB)
Affected Genes: WBGene00004259(pyr-1)
Genomic Alteration: WBGene00004259(pyr-1)
Availability: available
Source References: PMID:38991033
Synonyms: pyr-1(cu8) II.
Alternate IDs: WB-STRAIN:OK286, CGC_OK286
Notes: Partially penetrant Mel.

Proper citation: RRID:WB-STRAIN:WBStrain00029948 Copy   


  • RRID:WB-STRAIN:WBStrain00029944

http://www.wormbase.org/db/get?name=WBStrain00029944

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00004259(pyr-1)|WBGene00006744(unc-4)|WBGene00006787(unc-52)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00004259(pyr-1), WBGene00006744(unc-4), WBGene00006787(unc-52)
Availability: available
Source References: EMPTY
Synonyms: pyr-1(cu8) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II.
Alternate IDs: WB-STRAIN:OK245, CGC_OK245
Notes: Heterozygotes are WT and segregate WT, Dpy Steriles (mnC1 homozygotes), and Unc-4 animals which have a partially penetrant Mel phenotype.

Proper citation: RRID:WB-STRAIN:WBStrain00029944 Copy   


  • RRID:WB-STRAIN:WBStrain00029947

http://www.wormbase.org/db/get?name=WBStrain00029947

Source Database: WormBase (WB)
Affected Genes: WBGene00001065(dpy-3)|WBGene00003968(peb-1)|WBGene00006742(unc-2)
Genomic Alteration: WBGene00001065(dpy-3), WBGene00003968(peb-1), WBGene00006742(unc-2)
Availability: available
Source References: EMPTY
Synonyms: peb-1(cu9)/dpy-3(e27) unc-2(e55) X.
Alternate IDs: WB-STRAIN:OK257, CGC_OK257
Notes: Heterozygotes are WT and segregate WT, DpyUncs, and peb-1(cu9) homozygotes which arrest as larvae with a stuffed pharynx, abnormal hindgut and g1 gland cell morphology, and molting defects.|"Made_by: Anthony Fernandez"|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00029947 Copy   


  • RRID:WB-STRAIN:WBStrain00029946

http://www.wormbase.org/db/get?name=WBStrain00029946

Source Database: WormBase (WB)
Affected Genes: WBGene00002016(hsp-16.2)
Genomic Alteration: WBGene00002016(hsp-16.2)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:OK249
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00029946 Copy   


  • RRID:WB-STRAIN:WBStrain00029941

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00029941

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)
Genomic Alteration: WBGene00003514(myo-2)
Availability: available
Source References: PMID:37957360
Synonyms: cuIs2 IV.
Alternate IDs: WB-STRAIN:OK39, CGC_OK39
Notes: cuIs2 [myo-2c:: GFP + rol-6(su1006)]. Rollers.|"Made_by: Christina Haun"|"Mutagen:Gamma rays"|"Supplementary_genotype Myo-2c"

Proper citation: RRID:WB-STRAIN:WBStrain00029941 Copy   


  • RRID:WB-STRAIN:WBStrain00029943

http://www.wormbase.org/db/get?name=WBStrain00029943

Source Database: WormBase (WB)
Affected Genes: WBGene00000899(daf-3)
Genomic Alteration: WBGene00000899(daf-3)
Availability: available
Source References: EMPTY
Synonyms: cuIs2 IV; daf-3(mgDf90) X.
Alternate IDs: WB-STRAIN:OK68, CGC_OK68
Notes: Dauer defective. cuIs2 [myo-2c:: GFP + rol-6(su1006)]. Rollers. [NOTE: this strain was originally described as carrying daf-3(mg90), which is an old name for daf-3(mgDf90).]|"Made_by: Christina Haun"

Proper citation: RRID:WB-STRAIN:WBStrain00029943 Copy   


  • RRID:WB-STRAIN:WBStrain00029942

http://www.wormbase.org/db/get?name=WBStrain00029942

Source Database: WormBase (WB)
Affected Genes: WBGene00000900(daf-4)
Genomic Alteration: WBGene00000900(daf-4)
Availability: available
Source References: EMPTY
Synonyms: daf-4(m72) III; cuIs2/+ IV.
Alternate IDs: WB-STRAIN:OK66, CGC_OK66
Notes: cuIs2 [myo-2c:: GFP + rol-6(su1006)]. daf-4(m72) is a temperature sensitive dauer constitutive mutant. Maintain at 15C. It was problematic to get cuIs2 homozygous in this background. Pick Rollers to maintain.|"Made_by: Christina Haun"

Proper citation: RRID:WB-STRAIN:WBStrain00029942 Copy   


  • RRID:WB-STRAIN:WBStrain00029978

http://www.wormbase.org/db/get?name=WBStrain00029978

Source Database: WormBase (WB)
Affected Genes: WBGene00006545(tbx-8)
Genomic Alteration: WBGene00006545(tbx-8)
Availability: unknown
Source References: EMPTY
Synonyms: unc-119(ed3);wgIs59[WRM065A_G10(pRedFlp-Hgr)::unc-119-Nat(tbx-8[25160]::2XTY1-eGFP(C.ele)-3XFLAG)dFRT]
Alternate IDs: WB-STRAIN:OP59
Notes: Imported directly from the transgeneOme database.|"Modern strain"

Proper citation: RRID:WB-STRAIN:WBStrain00029978 Copy   


  • RRID:WB-STRAIN:WBStrain00029979

http://www.wormbase.org/db/get?name=WBStrain00029979

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; wgIs62.
Alternate IDs: WB-STRAIN:OP62, CGC_OP62
Notes: Made_by: modEncode|"Modern strain"|"wgIs62 [lin-11::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (URL: www.modencode.org)"

Proper citation: RRID:WB-STRAIN:WBStrain00029979 Copy   


  • RRID:WB-STRAIN:WBStrain00029976

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00029976

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: PMID:32628333
Synonyms: unc-119(ed3) III; gaEx290.
Alternate IDs: WB-STRAIN:OP56, CGC_OP56
Notes: gaEx290 [elt-2::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. Pick non-Unc to maintain. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Recombineered fosmid was integrated by biolistic bombardment. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Mann F, et al. PLoS. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (URL: www.modencode.org)|"gaEx290 [elt-2::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Recombineered fosmid was integrated by biolistic bombardment. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Mann F, et al. PLoS. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (URL: www.modencode.org)"|"gaIs290 [elt-2::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Recombineered fosmid was integrated by biolistic bombardment. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Mann F, et al. PLoS. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (URL: www.modencode.org)"|"Made_by: modENCODE"|"Modern strain"|"WBStrain mapped, WBPaper00059970 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00029976 Copy   


  • RRID:WB-STRAIN:WBStrain00029971

http://www.wormbase.org/db/get?name=WBStrain00029971

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:OP48
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00029971 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X