Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00032031
Source Database: WormBase (WB)
Affected Genes: WBGene00015062(trx-1)
Genomic Alteration: WBGene00015062(trx-1)
Availability: available
Source References: PMID:38446031
Synonyms: trx-1(ok1449) II.
Alternate IDs: WB-STRAIN:RB1332, CGC_RB1332
Notes: B0228.5 Homozygous. Outer Left Sequence: cgccgtggttaacctcttta. Outer Right Sequence: ttatcggacaataggcggac. Inner Left Sequence: ctgttgactcccaacaccct. Inner Right Sequence: ttgcaaaagaaattttcgcc. Inner Primer PCR Length: 2357. Estimated Deletion Size: about 850 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032031 Copy
http://www.wormbase.org/db/get?name=WBStrain00032039
Source Database: WormBase (WB)
Affected Genes: WBGene00003739(nlp-1)
Genomic Alteration: WBGene00003739(nlp-1)
Availability: available
Source References: EMPTY
Synonyms: nlp-1(ok1469) X.
Alternate IDs: WB-STRAIN:RB1340, CGC_RB1340
Notes: C01C4.1 Homozygous. Outer Left Sequence: gaaacattgtgctccaccct. Outer Right Sequence: attcagaagcggaaagagca. Inner Left Sequence: gtgcgtacccagagcatttt. Inner Right Sequence: caattgtgtcctccccctaa. Inner Primer PCR Length: 2212. Estimated Deletion Size: about 700 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032039 Copy
http://www.wormbase.org/db/get?name=WBStrain00032040
Source Database: WormBase (WB)
Affected Genes: WBGene00003739(nlp-1)
Genomic Alteration: WBGene00003739(nlp-1)
Availability: available
Source References: PMID:32576621, PMID:38573858
Synonyms: nlp-1(ok1470) X.
Alternate IDs: WB-STRAIN:RB1341, CGC_RB1341
Notes: C01C4.1 Homozygous. Outer Left Sequence: gaaacattgtgctccaccct. Outer Right Sequence: attcagaagcggaaagagca. Inner Left Sequence: gtgcgtacccagagcatttt. Inner Right Sequence: caattgtgtcctccccctaa. Inner Primer PCR Length: 2212. Estimated Deletion Size: about 600 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00059878 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00032040 Copy
http://www.wormbase.org/db/get?name=WBStrain00032041
Source Database: WormBase (WB)
Affected Genes: WBGene00003858(ogt-1)
Genomic Alteration: WBGene00003858(ogt-1)
Availability: available
Source References: PMID:32628333, PMID:37991448, PMID:38488606
Synonyms: ogt-1h
Alternate IDs: WB-STRAIN:RB1342, CGC_RB1342
Notes: K04G7.3 Homozygous. Outer Left Sequence: gccaaagaattgatttcgga. Outer Right Sequence: tgctcttgcaccacaaccta. Inner Left Sequence: acctgtccgagaccattctg. Inner Right Sequence: ccaacgctattgctcctctc. Inner Primer PCR Length: 2730. Estimated Deletion Size: about 1300 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00059970 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00032041 Copy
http://www.wormbase.org/db/get?name=WBStrain00032099
Source Database: WormBase (WB)
Affected Genes: WBGene00011834(dvc-1)
Genomic Alteration: WBGene00011834(dvc-1)
Availability: available
Source References: PMID:31839537
Synonyms: T19B10.6(ok260) V.
Alternate IDs: WB-STRAIN:RB1401, CGC_RB1401
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"T19B10.6. Unc."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032099 Copy
http://www.wormbase.org/db/get?name=WBStrain00032010
Source Database: WormBase (WB)
Affected Genes: WBGene00011036(edc-3)
Genomic Alteration: WBGene00011036(edc-3)
Availability: available
Source References: EMPTY
Synonyms: R05D11.8(ok1427) I.
Alternate IDs: WB-STRAIN:RB1311, CGC_RB1311
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"R05D11.8 Homozygous. Outer Left Sequence: gctgcgtgaacatcaagaaa. Outer Right Sequence: attccaacgacttgccaaag. Inner Left Sequence: tttgaccatggcgaatgtta. Inner Right Sequence: tagagggatcgctggagaaa. Inner Primer PCR Length: 2546. Estimated Deletion Size: about 800 bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032010 Copy
http://www.wormbase.org/db/get?name=WBStrain00032024
Source Database: WormBase (WB)
Affected Genes: WBGene00008278(npr-10)
Genomic Alteration: WBGene00008278(npr-10)
Availability: available
Source References: PMID:38446031
Synonyms: C53C7.1(ok1442) X.
Alternate IDs: WB-STRAIN:RB1325, CGC_RB1325
Notes: C53C7.1 Homozygous. Outer Left Sequence: ggatcgtcttgtggtgcttt. Outer Right Sequence: ggggcctcttaacctttttg. Inner Left Sequence: ctggattgccctgaaattgt. Inner Right Sequence: gcagacaaagcatgacctga. Inner Primer PCR Length: 3020. 11/18/04: From Neline Kriek: This has a 788 bp deletion with a 13 bp insertion (TTCTTTTTTTTGA). The sequence across the breakpoint is: actacgacgtggtgtctttTTCTTTTTTTTGAtgacgtgagtttt.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032024 Copy
http://www.wormbase.org/db/get?name=WBStrain00032020
Source Database: WormBase (WB)
Affected Genes: WBGene00016984(npr-8)
Genomic Alteration: WBGene00016984(npr-8)
Availability: available
Source References: EMPTY
Synonyms: C56G3.1(ok1439) X.
Alternate IDs: WB-STRAIN:RB1321, CGC_RB1321
Notes: C56G3.1 Homozygous. Outer Left Sequence: atagaaaggcaaccgggatt. Outer Right Sequence: cggtaagaaagcggaaatga. Inner Left Sequence: gtttgctctttttggtggga. Inner Right Sequence: catcgtccaatacaatgcga. Inner Primer PCR Length: 2408. Deletion Size: 838 bp deletion with a 1 bp insertion. Sequence across breakpoint from Neline Kriek: tggattggtgataatggctgtagtattgattattaataaccatattccaggaa.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032020 Copy
http://www.wormbase.org/db/get?name=WBStrain00032076
Source Database: WormBase (WB)
Affected Genes: WBGene00016716(acs-17)
Genomic Alteration: WBGene00016716(acs-17)
Availability: available
Source References: EMPTY
Synonyms: acs-17(ok1562) X.
Alternate IDs: WB-STRAIN:RB1377, CGC_RB1377
Notes: C46F4.2 Homozygous. Outer Left Sequence: ggtcgattcttcgatttcca. Outer Right Sequence: tggggagcataggtttttca. Inner Left Sequence: cctaaaacatatggccaccg. Inner Right Sequence: tgaacgcacggtatgtttgt. Inner Primer PCR Length: 3216. Estimated Deletion Size: about 1700 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032076 Copy
http://www.wormbase.org/db/get?name=WBStrain00032086
Source Database: WormBase (WB)
Affected Genes: WBGene00002090(ins-7)|WBGene00014240(htas-1)
Genomic Alteration: WBGene00002090(ins-7), WBGene00014240(htas-1)
Availability: available
Source References: EMPTY
Synonyms: ZK1251.1&ins-7(ok1573) IV.
Alternate IDs: WB-STRAIN:RB1388, CGC_RB1388
Notes: Made_by: Oklahoma KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK1251.1, ZK1251.2. Superficially wild type."
Proper citation: RRID:WB-STRAIN:WBStrain00032086 Copy
http://www.wormbase.org/db/get?name=WBStrain00032177
Source Database: WormBase (WB)
Affected Genes: WBGene00011488(nra-2)
Genomic Alteration: WBGene00011488(nra-2)
Availability: available
Source References: EMPTY
Synonyms: T05F1.1(ok1731) I.
Alternate IDs: WB-STRAIN:RB1480, CGC_RB1480
Notes: Made_by: OMRF Knockout Group|"T05F1.1 Homozygous. Outer Left Sequence: cttcaagagtggccatttcc. Outer Right Sequence: cttcaagagtggccatttcc. Inner Left Sequence: tttaatgcgggaaagtgacc. Inner Right Sequence: catgcgtgtgcctttaactg. Inner Primer PCR Length: 2592. Estimated Deletion Size: about 1100 bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032177 Copy
http://www.wormbase.org/db/get?name=WBStrain00032182
Source Database: WormBase (WB)
Affected Genes: WBGene00000820(csp-2)
Genomic Alteration: WBGene00000820(csp-2)
Availability: available
Source References: EMPTY
Synonyms: csp-2(ok1742) IV.
Alternate IDs: WB-STRAIN:RB1485, CGC_RB1485
Notes: Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y73B6BL.7. Homozygous. Outer Left Sequence: GCGACGAAGAATGTTCAGGT. Outer Right Sequence: TTATGTCTTGGTGCGTCTCG. Inner Left Sequence: AGATTGATCGGCTTTGCACT. Inner Right Sequence: AGATGCCGACGTCAATTTTC. Inner Primer PCR Length: 3112 bp. Deletion Size: 1722 bp. Deletion left flank: TTTCCAAATTCATAGGAAAAATACTCTGAA. Deletion right flank: TTGCAAATTCTTGAAAGTAAAGTCAACTTC."
Proper citation: RRID:WB-STRAIN:WBStrain00032182 Copy
http://www.wormbase.org/db/get?name=WBStrain00032180
Source Database: WormBase (WB)
Affected Genes: WBGene00002052(ifa-4)
Genomic Alteration: WBGene00002052(ifa-4)
Availability: available
Source References: EMPTY
Synonyms: ifa-4(ok1734) X.
Alternate IDs: WB-STRAIN:RB1483, CGC_RB1483
Notes: K05B2.3 Homozygous. Outer Left Sequence: atgtttcactttggcggttc. Outer Right Sequence: agagcgaataccgaagctca. Inner Left Sequence: cgagagtaattccgggttca. Inner Right Sequence: tcgcaagatggagaaggact. Inner Primer PCR Length: 2608. Estimated Deletion Size: about 600 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032180 Copy
http://www.wormbase.org/db/get?name=WBStrain00032103
Source Database: WormBase (WB)
Affected Genes: WBGene00022004(npr-22)
Genomic Alteration: WBGene00022004(npr-22)
Availability: available
Source References: PMID:37310929, PMID:38446031
Synonyms: Y59H11AL.1(ok1598) IV.
Alternate IDs: WB-STRAIN:RB1405, CGC_RB1405
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y59H11AL.1 Homozygous. Outer Left Sequence: tggaacacttccccaaactc. Outer Right Sequence: tgatacgggaaaagctacgc. Inner Left Sequence: ggaagcagtttgctctccag. Inner Right Sequence: aattggcagagttgtttcgg. Inner Primer PCR Length: 3299. Estimated Deletion Size: about 2500 bp."
Proper citation: RRID:WB-STRAIN:WBStrain00032103 Copy
http://www.wormbase.org/db/get?name=WBStrain00032184
Source Database: WormBase (WB)
Affected Genes: WBGene00000213(asm-3)
Genomic Alteration: WBGene00000213(asm-3)
Availability: available
Source References: PMID:31940482
Synonyms: asm-3(ok1744) IV.
Alternate IDs: WB-STRAIN:RB1487, CGC_RB1487
Notes: Made_by: OMRF Knockout Group|"Reference WBPaper00059117 added based on published strain data identified by Textpresso literature search."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"W03G1.7 Homozygous. Outer Left Sequence: aagccagaattccgtgtttg. Outer Right Sequence: tcgtcctttctctcgcattt. Inner Left Sequence: cttgcactcctcctttccac. Inner Right Sequence: ggtgacagaatgcgaggaat. Inner Primer PCR Length: 3344. Estimated Deletion Size: about 1400 bp."
Proper citation: RRID:WB-STRAIN:WBStrain00032184 Copy
http://www.wormbase.org/db/get?name=WBStrain00032163
Source Database: WormBase (WB)
Affected Genes: WBGene00016020(sptl-1)
Genomic Alteration: WBGene00016020(sptl-1)
Availability: available
Source References: PMID:25437839
Synonyms: C23H3.4(ok1693) II.
Alternate IDs: WB-STRAIN:RB1465, CGC_RB1465
Notes: C23H3.4. Homozygous. Outer Left Sequence: CCAAATTCCCCACTTACCCT. Outer Right Sequence: CTGAAATTTTGCCACGGATT. Inner Left Sequence: AGCCCAAGCCAATTATCCTT. Inner Right Sequence: AACACGAACTTTGAATCGCC. Inner Primer PCR Length: 3320 bp. Deletion Size: 963 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032163 Copy
http://www.wormbase.org/db/get?name=WBStrain00032170
Source Database: WormBase (WB)
Affected Genes: WBGene00006578(tli-1)
Genomic Alteration: WBGene00006578(tli-1)
Availability: available
Source References: EMPTY
Synonyms: tli-1(ok1724) I.
Alternate IDs: WB-STRAIN:RB1473, CGC_RB1473
Notes: F25H2.1 Homozygous. Outer Left Sequence: tccagcaagaccttcgaaac. Outer Right Sequence: tgctgaacgtcgtagacagg. Inner Left Sequence: gagccaacaccaagcagaat. Inner Right Sequence: ttacaggtgctcgttggaga. Inner Primer PCR Length: 2848. Estimated Deletion Size: about 600 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032170 Copy
http://www.wormbase.org/db/get?name=WBStrain00032134
Source Database: WormBase (WB)
Affected Genes: WBGene00016945(sulp-1)
Genomic Alteration: WBGene00016945(sulp-1)
Availability: available
Source References: EMPTY
Synonyms: sulp-1(ok1639) I.
Alternate IDs: WB-STRAIN:RB1436, CGC_RB1436
Notes: C55B7.6. Homozygous. Outer Left Sequence: CACGTGGTACTGGCAGAAAA. Outer Right Sequence: CGGGTACACCAGCCAATAGT. Inner Left Sequence: AAACACGGAACTTGCCAAAC. Inner Right Sequence: CAAATGTCCGTTCACACCTG. Inner Primer PCR Length: 2950 bp. Deletion Size: 1004 bp. Deletion left flank: ATTTTTTATTCCTCTACATGGGATGCGGTT. Deletion right flank: ACCCTTCTTCAGCAAAAATAATATTTTTTT. Insertion Sequence: CCTCTACATGGGAT.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032134 Copy
http://www.wormbase.org/db/get?name=WBStrain00032195
Source Database: WormBase (WB)
Affected Genes: WBGene00002044(hyl-2)
Genomic Alteration: WBGene00002044(hyl-2)
Availability: available
Source References: EMPTY
Synonyms: hyl-2(ok1766) X.
Alternate IDs: WB-STRAIN:RB1498, CGC_RB1498
Notes: K02G10.6 Homozygous. Outer Left Sequence: acgcagtttccaagcatttc. Outer Right Sequence: tccttttcctcctcggtttt. Inner Left Sequence: gggggagtgatggaagaaat. Inner Right Sequence: ttgcaaaccaattgcaagaa. Inner Primer PCR Length: 3075. Estimated Deletion Size: about 1600 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032195 Copy
http://www.wormbase.org/db/get?name=WBStrain00032118
Source Database: WormBase (WB)
Affected Genes: WBGene00019993(rbx-2)
Genomic Alteration: WBGene00019993(rbx-2)
Availability: available
Source References: EMPTY
Synonyms: rbx-2(ok1617) I.
Alternate IDs: WB-STRAIN:RB1420, CGC_RB1420
Notes: Made_by: OMRF Knockout Group|"R10A10.2. Homozygous. Outer Left Sequence: CATCTCCACGAGCACTGAAA. Outer Right Sequence: AACAGACGGAAAACGACCAG. Inner Left Sequence: CGGTGGAAAAACTCTGGAAA. Inner Right Sequence: CGTCTCCTCCGAAATTGAAA. Inner Primer PCR Length: 2101 bp. Deletion Size: 759 bp."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032118 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.