Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
dpm-1(gk5818[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051416 | Caenorhabditis elegans | dpm-1(gk5818[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2579 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GTTTCACATGAAGTGATTATCGTTGACGAT. Right flanking sequence: GTTTCCAAACATTCTTGTTTAAATTATATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00022044(dpm-1) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00022044(dpm-1) | WB-STRAIN:WBStrain00051416 | WormBase (WB) | WB | unknown | 2026-08-15 09:37:41 | 0 | ||||
|
pigb-1(gk5817[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051415 | Caenorhabditis elegans | pigb-1(gk5817[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1524 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CAAGGAGATTAATAAGAAATAATAGGACCT. Right flanking sequence: TGGTAGCCACTGATTTGCTGCTTCCAGATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00194986(pigb-1) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00194986(pigb-1) | WB-STRAIN:WBStrain00051415 | WormBase (WB) | WB | unknown | 2026-08-15 09:37:41 | 0 | ||||
|
pad-1(gk5820[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051418 | Caenorhabditis elegans | pad-1(gk5820[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 24013 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTTTCACGCTCTTTCCCCCATTTTTCCCCA. Right flanking sequence: GGGTAGGCAACATTTTTATTTCCAACTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. [NOTE: Maintain this strain with care! Non-GFP animals can quickly overtake a population. GFP expression is mottled: the pharynx can look sort of sectored, with bright portions and dim or non-GFP portions, and some GFP animals will throw only non-GFP progeny.]|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00003905(pad-1)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00003905(pad-1), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051418 | WormBase (WB) | WB | unknown | 2026-08-15 09:37:41 | 0 | ||||
|
mdt-17(gk5819[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051417 | Caenorhabditis elegans | mdt-17(gk5819[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 14905 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TATTGTTACGTGACATTGTTGAGACCATTG. Right flanking sequence: CGGCTCGATAGGCTCCACCACTTCATCGCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00007017(mdt-17) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00007017(mdt-17) | WB-STRAIN:WBStrain00051417 | WormBase (WB) | WB | unknown | 2026-08-15 09:37:41 | 0 | ||||
|
best-5(gk5757[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051360 | Caenorhabditis elegans | best-5(gk5757[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. | Homozygous viable. Deletion of 3334 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: ATTGATTAAATTCTTAAATTAGAACCCGTT. Right flanking sequence: TTGGCATTTATTTGACGCCAAAAAATTTAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00007404(best-5) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00007404(best-5) | WB-STRAIN:WBStrain00051360 | WormBase (WB) | WB | unknown | 2026-08-15 09:37:40 | 0 | ||||
|
D2096.9(gk5759[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051362 | Caenorhabditis elegans | D2096.9(gk5759[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 957 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CACTTCACGCGAGCAGAACGCCCTTGCCTT. Right flanking sequence: TGCGGAAAAAATGCACACTCTTTGGTATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051362 | WormBase (WB) | WB | unknown | 2026-08-15 09:37:40 | 0 | ||||
|
vha-13(gk5758[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051361 | Caenorhabditis elegans | vha-13(gk5758[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. | Made_by: Vancouver KO Group|"[NOTE: Please see RG5045 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2243 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTCCAGGAAAAGATGGCCGCAGAATCTTCG. Right flanking sequence: CGCTAGATTCTGTTCAGTTTTGCTGAGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00013025(vha-13) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00013025(vha-13) | WB-STRAIN:WBStrain00051361 | WormBase (WB) | WB | unknown | 2026-08-15 09:37:40 | 0 | ||||
|
T04G9.4(gk5765[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051368 | Caenorhabditis elegans | T04G9.4(gk5765[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ X. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2739 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AAACAATTCATCCTACTCGTTTGTTGGCAG. Right flanking sequence: TAATCCGTGATGCCTACTAACTAAATTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051368 | WormBase (WB) | WB | unknown | 2026-08-15 09:37:40 | 0 | ||||
|
rbm-28(gk5802[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051401 | Caenorhabditis elegans | rbm-28(gk5802[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 7457 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AATAATAATATTAATAGTAAAATATATTAA. Right flanking sequence: AGGCATCAACACTCCATTGTAGTCCCTCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00011043(rbm-28) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00011043(rbm-28) | WB-STRAIN:WBStrain00051401 | WormBase (WB) | WB | unknown | 2026-08-15 09:37:41 | 0 | ||||
|
lars-1(gk5763[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051366 | Caenorhabditis elegans | lars-1(gk5763[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. | Made_by: Vancouver KO Group|"[NOTE: Please see RG5042 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 5294 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GACGTTAGCCTTGTACACAATAGTACGCCC. Right flanking sequence: TGGCCTAGTTTTGCAATGGCATCGACCGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00003073(lars-1)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003073(lars-1), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051366 | WormBase (WB) | WB | unknown | 2026-08-15 09:37:40 | 0 | ||||
|
YG1011 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040718 | Caenorhabditis elegans | baf-1(gk324) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); qIs19 V. | qIs19 [lag-2p::GFP::unc-54 3'UTR + rol-6(su1006)] V. Heterozygotes are Rollers with pharyngeal GFP signal, and segregate arrested hT2 aneuploids, and non-GFP gk324 homozygotes (Sterile and Unc). All worms express lag-2p::GFP at the distal tip cells. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. | WBGene00000235(baf-1)|WBGene00000254(bli-4)|WBGene00001578(ges-1)|WBGene00002246(lag-2)|WBGene00003514(myo-2)|WBGene00003983(pes-10) | WBGene00000235(baf-1), WBGene00000254(bli-4), WBGene00001578(ges-1), WBGene00002246(lag-2), WBGene00003514(myo-2), WBGene00003983(pes-10) | WB-STRAIN:WBStrain00040718 | WormBase (WB) | WB | available | WB-STRAIN:YG1011, CGC_YG1011 | 2026-08-15 09:34:24 | 0 | |||
|
YG1021 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040720 | Caenorhabditis elegans | baf-1(gk324) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); ccIs4810 X. | ccIs4810 [(pJKL380.4) lmn-1p::lmn-1::GFP::lmn-1 3'utr + (pMH86) dpy-20(+)] X. Heterozygotes are WT with pharyngeal GFP signal, and segregate arrested hT2 aneuploids, non-GFP gk324 homozygotes (Sterile and Unc). All worms express Cel-lamin::GFP (lmn-1 gene is expressed at the nuclear periphery). qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. | WBGene00000235(baf-1)|WBGene00000254(bli-4)|WBGene00001578(ges-1)|WBGene00003052(lmn-1)|WBGene00003514(myo-2)|WBGene00003983(pes-10) | WBGene00000235(baf-1), WBGene00000254(bli-4), WBGene00001578(ges-1), WBGene00003052(lmn-1), WBGene00003514(myo-2), WBGene00003983(pes-10) | WB-STRAIN:WBStrain00040720 | WormBase (WB) | WB | available | WB-STRAIN:YG1021, CGC_YG1021 | 2026-08-15 09:34:24 | 0 | |||
|
JU617 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00041121 | Caenorhabditis briggsae | EMPTY | Non-elegans Strain | WBGene00003514(myo-2)|WBGene00028342(Cbr-lin-3) | WBGene00003514(myo-2), WBGene00028342(Cbr-lin-3) | WB-STRAIN:WBStrain00041121 | WormBase (WB) | WB | unknown | WB-STRAIN:JU617 | 2026-08-15 09:34:32 | 0 | |||
|
JU616 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00041120 | Caenorhabditis briggsae | EMPTY | Non-elegans Strain | WBGene00003514(myo-2)|WBGene00028342(Cbr-lin-3) | WBGene00003514(myo-2), WBGene00028342(Cbr-lin-3) | WB-STRAIN:WBStrain00041120 | WormBase (WB) | WB | unknown | WB-STRAIN:JU616 | 2026-08-15 09:34:32 | 0 | |||
|
JU610 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00041118 | Caenorhabditis briggsae | EMPTY | Non-elegans Strain | WBGene00003514(myo-2)|WBGene00030012(Cbr-egl-17) | WBGene00003514(myo-2), WBGene00030012(Cbr-egl-17) | WB-STRAIN:WBStrain00041118 | WormBase (WB) | WB | unknown | WB-STRAIN:JU610 | 2026-08-15 09:34:32 | 0 | |||
|
JU613 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00041119 | Caenorhabditis briggsae | EMPTY | Non-elegans Strain | WBGene00003514(myo-2)|WBGene00030720(Cbr-zmp-1) | WBGene00003514(myo-2), WBGene00030720(Cbr-zmp-1) | WB-STRAIN:WBStrain00041119 | WormBase (WB) | WB | unknown | WB-STRAIN:JU613 | 2026-08-15 09:34:32 | 0 | |||
|
mir-61(umn14[lox2272 + myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR Lox511I + Lox2272]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047228 | Caenorhabditis elegans | mir-61(umn14[lox2272 + myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR Lox511I + Lox2272]) V. | Made_by: Julie Knott & Marcus Vargas|"mir-61 pre-miRNA deletion strain deletion allele in which mir-61 pre-miRNA was replaced by myo-2p::wrmScarlet. Generated in parental strain N2. Rollers. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]" | WBGene00003289(mir-61)|WBGene00003514(myo-2)|WBGene00005016(sqt-1) | WBGene00003289(mir-61), WBGene00003514(myo-2), WBGene00005016(sqt-1) | WB-STRAIN:WBStrain00047228 | WormBase (WB) | WB | unknown | 2026-08-15 09:36:18 | 0 | ||||
|
mir-785(umn32[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR Lox511I + Lox2272]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047237 | Caenorhabditis elegans | mir-785(umn32[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR Lox511I + Lox2272]) X. | Made_by: Julie Knott & Marcus Vargas|"mir-785 pre-miRNA deletion strain deletion allele in which mir-785 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]" | WBGene00003514(myo-2)|WBGene00005016(sqt-1)|WBGene00045342(mir-785) | WBGene00003514(myo-2), WBGene00005016(sqt-1), WBGene00045342(mir-785) | WB-STRAIN:WBStrain00047237 | WormBase (WB) | WB | unknown | 2026-08-15 09:36:18 | 0 | ||||
|
mir-356(umn42[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR LoX511I + Lox2272]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047239 | Caenorhabditis elegans | mir-356(umn42[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR LoX511I + Lox2272]) III. | Made_by: Julie Knott & Marcus Vargas|"mir-356 pre-miRNA deletion strain deletion allele in which mir-356 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]" | WBGene00003514(myo-2)|WBGene00005016(sqt-1) | WBGene00003514(myo-2), WBGene00005016(sqt-1) | WB-STRAIN:WBStrain00047239 | WormBase (WB) | WB | unknown | 2026-08-15 09:36:18 | 0 | ||||
|
dad-1(ve587[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; + /hT1 [unc-42(e270)] V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049330 | Caenorhabditis elegans | dad-1(ve587[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; + /hT1 [unc-42(e270)] V. | Made_by: RG KO Group|"umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous larval arrest. Deletion of 699 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve587 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: gtgtaacacagcaagagaaacgaaacccca ; Right flanking sequence: TTTGGTAGTCATCGAACAGTTTCGAGAGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00000896(dad-1)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006778(unc-42)|WBGene00006789(unc-54) | WBGene00000896(dad-1), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006778(unc-42), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00049330 | WormBase (WB) | WB | unknown | 2026-08-15 09:36:57 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
