Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
VC3874 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037827 | Caenorhabditis elegans | +/nT1 IV; hmgs-1(gk3838[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 V . | Made_by: Vancouver KO Group|"Recessive lethal deletion balanced by nT1. Deletion of 1177 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATTGCGACTTGACGAATTTTATCAAGATTA; Right flanking sequence: ATACGATGTCCTCGTTGTCCGAGCAGAATC. See WormBase Variation gk3838 for details." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00017769(hmgs-1) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00017769(hmgs-1) | WB-STRAIN:WBStrain00037827 | WormBase (WB) | WB | available | WB-STRAIN:VC3874, CGC_VC3874 | 2026-08-15 09:33:33 | 0 | |||
|
VC3832 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037824 | Caenorhabditis elegans | ubc-6(gk3799[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. | Homozygous viable. Deletion of 861 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CATGCACAACCAATGGAAGACAATCTTTTT; Right flanking sequence: TGGTATTCCAACACCACGCTCCCCGCTTGG. See WormBase Variation gk3799 for details.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006703(ubc-6)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006703(ubc-6), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00037824 | WormBase (WB) | WB | available | WB-STRAIN:VC3832, CGC_VC3832 | 2026-08-15 09:33:33 | 0 | |||
|
VC3876 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037829 | Caenorhabditis elegans | C33F10.8(gk3755) II; F28C1.1(gk3756) V. | Homozygous viable. Nonsense alleles identified by amplicon sequencing.|"Made_by: Vancouver KO Group" | WBGene00009200(F28C1.1)|WBGene00016356(C33F10.8) | WBGene00009200(F28C1.1), WBGene00016356(C33F10.8) | WB-STRAIN:WBStrain00037829 | WormBase (WB) | WB | available | WB-STRAIN:VC3876, CGC_VC3876 | 2026-08-15 09:33:33 | 0 | |||
|
VC3830 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037822 | Caenorhabditis elegans | F13H8.2(gk3816)/mIn1[dpy-10(e128) umnIs33] II. | Made_by: Vancouver KO Group|"umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Recessive lethal. Nonsense allele identified by amplicon sequencing, balanced by inversion marked with dpy-10 and myo-2 GFP. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, non-GFP gk3816 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ and check for correct segregation of progeny to maintain." | WBGene00001072(dpy-10)|WBGene00017435(F13H8.2) | WBGene00001072(dpy-10), WBGene00017435(F13H8.2) | WB-STRAIN:WBStrain00037822 | WormBase (WB) | WB | available | WB-STRAIN:VC3830, CGC_VC3830 | 2026-08-15 09:33:33 | 0 | |||
|
VC3831 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037823 | Caenorhabditis elegans | C15A7.2(gk3798[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. | Homozygous viable. Deletion of 2034 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATGTCACAATGTTATCCACAATGTTCACCA; Right flanking sequence: CAAAATATAGAAGGAGCATTTGAGTTGGGT. See WormBase Variation gk3798 for details.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00037823 | WormBase (WB) | WB | available | WB-STRAIN:VC3831, CGC_VC3831 | 2026-08-15 09:33:33 | 0 | |||
|
VC3824 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037821 | Caenorhabditis elegans | sel-11(gk3792[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. | Homozygous viable. Deletion of 2037 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGGTGGCTCGTGTGTGGCGACTGCGGCCA; Right flanking sequence: CGGACCGTCAACAGATCAAGTCACTTCGGA. See WormBase Variation gk3792 for details.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00004768(sel-11)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00004768(sel-11), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00037821 | WormBase (WB) | WB | available | WB-STRAIN:VC3824, CGC_VC3824 | 2026-08-15 09:33:33 | 0 | |||
|
VC3892 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037837 | Caenorhabditis elegans | vamp-8(gk3845[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 1092 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCAGTTCCTATTTCAAACAAAAAAACTCCA; Right flanking sequence: GGGCTTGTTGCTGTCGTTTTCCATTGACTG. See WormBase Variation gk3845 for details.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00007200(vamp-8) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00007200(vamp-8) | WB-STRAIN:WBStrain00037837 | WormBase (WB) | WB | available | WB-STRAIN:VC3892, CGC_VC3892 | 2026-08-15 09:33:33 | 0 | |||
|
VC3625 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037804 | Caenorhabditis elegans | nhr-286(gk3859) V. | Homozygous viable. Deletion of 72 bp with AAAAAAAAAA inserted at break. Left flanking sequence: GGCTATAAGAAGTTGGAGTGCATAAATGAC; Right flanking sequence: TTTTGATCTCAGTTATTACATTAATCAAGG. See WormBase Variation gk3859 for details. | WBGene00044699(nhr-286) | WBGene00044699(nhr-286) | WB-STRAIN:WBStrain00037804 | WormBase (WB) | WB | available | WB-STRAIN:VC3625, CGC_VC3625 | 2026-08-15 09:33:33 | 0 | |||
|
VC3575 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037802 | Caenorhabditis elegans | sma-2(ok3109)/qC1 [dpy-19(e1259) glp-1(q339)] III. | This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"ZK370.2. Apparent homozygous lethal deletion chromosome balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and ok3109 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTCGCTGATTCCAGTCGTTT. External right primer: AGCTAAATCCGCACACGAAC. Internal left primer: TAAACAGCATGCGGTGGAAT. Internal right primer: TGAAAAATTTGGCTCCGAGT. Internal WT amplicon: 1222 bp. Deletion size: 707 bp. Deletion left flank: AATAACTTTGAGAGGGAAAAGGTTACGAAA. Deletion right flank: TCACTGAAGATTTTCGATATGGAGATTTTT. Insertion sequence: TCACTGAAGATTTTCGATATGTATTTGAGAGGGAAAAGGTTACGAAA." | WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00004856(sma-2) | WBGene00001078(dpy-19), WBGene00001609(glp-1), WBGene00004856(sma-2) | WB-STRAIN:WBStrain00037802 | WormBase (WB) | WB | available | WB-STRAIN:VC3575, CGC_VC3575 | 2026-08-15 09:33:33 | 0 | |||
|
VC3622 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037803 | Caenorhabditis elegans | T26A5.8(gk3858) III. | Homozygous viable. Deletion of 7 bp. Left flanking sequence: AGCCTTCTGCTGACTAATAACTTTCCATTT; Right flanking sequence: GCGGACTTGCACTGGAAATTTTAATTTCTT. See WormBase Variation gk3858 for details. | WBGene00020823(pole-3) | WBGene00020823(pole-3) | WB-STRAIN:WBStrain00037803 | WormBase (WB) | WB | available | WB-STRAIN:VC3622, CGC_VC3622 | 2026-08-15 09:33:33 | 0 | |||
|
VC3737 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037808 | Caenorhabditis elegans | rap-3(gk3695[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 536 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAGTAGTTCTTTAAATGACTACTGTAGTGT; Right flanking sequence: TGGTAACTAATCTCAAATAGATTTTAAATT. See WormBase Variation gk3695 for details.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004309(rap-3)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004309(rap-3), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00037808 | WormBase (WB) | WB | available | WB-STRAIN:VC3737, CGC_VC3737 | 2026-08-15 09:33:33 | 0 | |||
|
VC3742 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037809 | Caenorhabditis elegans | C52B11.5(gk3700[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. | Homozygous viable. Deletion of 1047 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTATTTGGACAACGCTCTGTGCACAAATCA; Right flanking sequence: TGGCTTAACGAATGAAGATAATGGATTCAA. See WormBase Variation gk3700 for details.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00037809 | WormBase (WB) | WB | available | WB-STRAIN:VC3742, CGC_VC3742 | 2026-08-15 09:33:33 | 0 | |||
|
VC4036 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037888 | Caenorhabditis elegans | H23N18.4(gk5109[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. | Homozygous viable. Deletion of 2206 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAGTTGCATAAAAAACTACAAAATGATGCT ; Right flanking sequence: TTTGGGAAAATAAAACATGCCCAGAACTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00037888 | WormBase (WB) | WB | available | WB-STRAIN:VC4036, CGC_VC4036 | 2026-08-15 09:33:34 | 0 | |||
|
VC4038 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037889 | Caenorhabditis elegans | C10C5.3(gk5112[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 1852 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAATACGGTAAGTAATGTCTTATGCCTGCG ; Right flanking sequence: CCAGGTATTGAAATCTACCAAACGCTGATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00037889 | WormBase (WB) | WB | available | WB-STRAIN:VC4038, CGC_VC4038 | 2026-08-15 09:33:34 | 0 | |||
|
VC4042 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037891 | Caenorhabditis elegans | C34D10.2(gk5116[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. | Homozygous viable. Deletion of 6402 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCGATTATTTTCAACGCTGGCCAACCGCCG ; Right flanking sequence: CTCGTCAACTCATCTTCTACCAAATTTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00037891 | WormBase (WB) | WB | available | WB-STRAIN:VC4042, CGC_VC4042 | 2026-08-15 09:33:34 | 0 | |||
|
VC3802 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037815 | Caenorhabditis elegans | F11A10.7(gk3769[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 857 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GATGATCAGCCGTACTATTGATACTCTATG; Right flanking sequence: TGGACGATCATGTGATTCGTGTTGACAAAG. See WormBase Variation gk3769 for details.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00037815 | WormBase (WB) | WB | available | WB-STRAIN:VC3802, CGC_VC3802 | 2026-08-15 09:33:33 | 0 | |||
|
VC3805 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037817 | Caenorhabditis elegans | gkDf63[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP] X. | Homozygous viable. Deletion of 5664 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACCAAACTAAACGCTCTGGACGTGAACATG; Right flanking sequence: GGGGCGCATTTATAGCAAAAACTTCCCAAT. See WormBase Rearrangement gkDf63 for details.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00037817 | WormBase (WB) | WB | available | WB-STRAIN:VC3805, CGC_VC3805 | 2026-08-15 09:33:33 | 0 | |||
|
VC3807 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037818 | Caenorhabditis elegans | gkDf64[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP] III. | Homozygous viable. Deletion of 17117 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATTGAGTCCTCAACTTTTCATTCTGTTGTA; Right flanking sequence: AGGAAATTGTCCCACAAGTTTGAAATGGTA. See WormBase Rearrangement gkDf64 for details.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00037818 | WormBase (WB) | WB | available | WB-STRAIN:VC3807, CGC_VC3807 | 2026-08-15 09:33:33 | 0 | |||
|
VC4054 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037896 | Caenorhabditis elegans | cpt-5(gk5128[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. | Homozygous viable. Deletion of 2432 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTCAATAAAATGTAGCATTAAGTGTAGCCA ; Right flanking sequence: ATGTATGTTTTCCGAATTATTTTTCGCAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00008629(cpt-5) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00008629(cpt-5) | WB-STRAIN:WBStrain00037896 | WormBase (WB) | WB | available | WB-STRAIN:VC4054, CGC_VC4054 | 2026-08-15 09:33:34 | 0 | |||
|
VC3788 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037811 | Caenorhabditis elegans | ZK673.2(gk3749) II; lipl-5(gk3748) V. | Homozygous viable. Nonsense alleles identified by amplicon sequencing.|"Made_by: Vancouver KO Group" | WBGene00014058(ZK673.2)|WBGene00022642(lipl-5) | WBGene00014058(ZK673.2), WBGene00022642(lipl-5) | WB-STRAIN:WBStrain00037811 | WormBase (WB) | WB | available | WB-STRAIN:VC3788, CGC_VC3788 | 2026-08-15 09:33:33 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
