Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
dct-1(luc194) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051773 | Caenorhabditis elegans | dct-1(luc194) X. | CRISPR/Cas9-engineered deletion removes the entire dct-1 coding sequence. Homozygote mutant animals are viable and have normal morphology. Outer left sequence: gtttcagagacgggtctttcctaaca Outer right sequence: ttccaaacaaaaattttaacgttcgactta sgRNA1: ACAGCAGACGGAGCAGTCAT sgRNA2: GTACAGTGAAATGAGGTAAG Reference: Gutierrez-Prez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.|"CRISPR/Cas9-engineered deletion removes the entire dct-t coding sequence. Homozygote mutant animals are viable and have normal morphology. Outer left sequence: gtttcagagacgggtctttcctaaca Outer right sequence: ttccaaacaaaaattttaacgttcgactta sgRNA1: ACAGCAGACGGAGCAGTCAT sgRNA2: GTACAGTGAAATGAGGTAAG Reference: Gutierrez-Prez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644."|"Made_by: Paula Gutirrez-Prez" | WBGene00015776(dct-1) | WBGene00015776(dct-1) | WB-STRAIN:WBStrain00051773 | WormBase (WB) | WB | unknown | 2026-09-05 04:57:14 | 0 | ||||
|
oxIs322 II; unc-119(ed3) III; lucEx1311. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051772 | Caenorhabditis elegans | oxIs322 II; unc-119(ed3) III; lucEx1311. | Made_by: Paula Gutirrez-Prez|"oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + Cbr-unc-119(+)]. lucEx1311 (myo-3p::R2pH::LAMP1::3xFLAG::unc-54 3UTR + ttx-3p::mCherry). Pick mCherry+ to maintain. Reference: Gutierrez-Perez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644." | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00051772 | WormBase (WB) | WB | unknown | 2026-09-05 04:57:14 | 0 | ||||
|
daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III; ieSi38 IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051779 | Caenorhabditis elegans | daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III; ieSi38 IV. | ieSi38 [sun-1p::TIR1::mRuby::sun-1 3' UTR + Cbr-unc-119(+)] IV. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. A single copy transgene was inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the germ line.|"Made_by: Yan-Ping Zhang, Wen-Hong Zhang" | WBGene00000898(daf-2)|WBGene00006843(unc-119) | WBGene00000898(daf-2), WBGene00006843(unc-119) | WB-STRAIN:WBStrain00051779 | WormBase (WB) | WB | unknown | 2026-09-05 04:57:14 | 0 | ||||
|
ieSi61 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051778 | Caenorhabditis elegans | ieSi61 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III. | ieSi61 [ges-1p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. A single copy transgene was inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the intestine. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the intestine. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https:|"Made_by: Yan-Ping Zhang, Wen-Hong Zhang" | WBGene00000898(daf-2)|WBGene00006843(unc-119) | WBGene00000898(daf-2), WBGene00006843(unc-119) | WB-STRAIN:WBStrain00051778 | WormBase (WB) | WB | unknown | 2026-09-05 04:57:14 | 0 | ||||
|
hqSi8 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051777 | Caenorhabditis elegans | hqSi8 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III. | hqSi8 [rgef-1p::TIR1::mRuby::unc-54 3UTR+Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi8 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the rgef-1 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the neurons. hqSi8 previously known as hq373. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https:|"Made_by: Yan-Ping Zhang, Wen-Hong Zhang" | WBGene00000898(daf-2)|WBGene00006843(unc-119) | WBGene00000898(daf-2), WBGene00006843(unc-119) | WB-STRAIN:WBStrain00051777 | WormBase (WB) | WB | unknown | 2026-09-05 04:57:14 | 0 | ||||
|
cdc-7(knu709) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051815 | Caenorhabditis elegans | cdc-7(knu709) I. | CRISPR-engineered deletion removing entire cdc-7 gene. Out-crossed 3x to N2. Reference: Currey HN & Liachko NF. 2019. A CRISPR/Cas9-generated cdc-7 loss of function mutation does not cause temperature-dependent fertility defects. microPublication Biology. Jan 3;2019:10.17912. | WBGene00016421(cdc-7) | WBGene00016421(cdc-7) | WB-STRAIN:WBStrain00051815 | WormBase (WB) | WB | unknown | 2026-09-05 04:57:15 | 0 | ||||
|
zdIs13 IV; vlcEx1290. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051813 | Caenorhabditis elegans | zdIs13 IV; vlcEx1290. | zdIs13 [tph-1p::GFP] IV. vlcEx1288 [hsp16.2p::lag-1D(cDNA) + ttx-3::mCherry + rol-6(su1006)]. Pick Rollers to maintain. Heatshock induces expression of LAG-1D. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334 | WB-STRAIN:WBStrain00051813 | WormBase (WB) | WB | unknown | 2026-09-05 04:57:15 | 0 | ||||||
|
jsSi1669 IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051818 | Caenorhabditis elegans | jsSi1669 IV. | jsSi1669 [loxP::mex-5p::FLP::D5::sl2::mNG::glh-2::3 rpl-28p::FRT::GFP::his-58::FRT3] IV. Single component RMCE landing site on Chr IV adjacent to the site of the commonly used ttTi10882 MosSCi insertion site. | WB-STRAIN:WBStrain00051818 | WormBase (WB) | WB | unknown | PMID:38302462 | 2026-09-05 04:57:15 | 0 | |||||
|
jsSi1579 II; bqSi711 IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051817 | Caenorhabditis elegans | jsSi1579 II; bqSi711 IV. | jsSi1579 [loxP::rpl-28p::FRT::GFP::his-58 FRT3] II. bqSi711 [mex-5p::FLP::SL2::mNG + unc-119(+)] IV. Dual component RMCE landing site on Chr II adjacent to the site of the commonly used ttTi5605 MosSCi insertion site. | WB-STRAIN:WBStrain00051817 | WormBase (WB) | WB | unknown | PMID:39652010 | 2026-09-05 04:57:15 | 0 | |||||
|
vha-11(luc130) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051762 | Caenorhabditis elegans | vha-11(luc130) IV. | Made_by: Paula Gutirrez-Prez|"vha-11 gain-of-function allele created by replacing the miR-1 binding site (ACATTCCA) in the 3' UTR of the endogenous locus with a NotI (GCGGCCGC) restriction site. Reference: Gutierrez-Prez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644." | WBGene00006920(vha-11) | WBGene00006920(vha-11) | WB-STRAIN:WBStrain00051762 | WormBase (WB) | WB | unknown | 2026-09-05 04:57:14 | 0 | ||||
|
lucEx421. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051761 | Caenorhabditis elegans | lucEx421. | lucEx421 [mir-4813p::myr::GFP::unc-54 3UTR + ttx-3p::mCherry]. Pick mCherry+ animals to maintain. Reporter contains 1kb upstream mir-4813 promoter sequence and 1kb unc-54 3UTR downstream sequence. Provides a marker for pharyngeal muscle cell-cell fusion. Reference: Gutierrez-Prez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.|"Made_by: Thomas Steinacker" | WB-STRAIN:WBStrain00051761 | WormBase (WB) | WB | unknown | 2026-09-05 04:57:14 | 0 | ||||||
|
twk-16(syb2541[wrmScarlet::degron::twk-16]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051801 | Caenorhabditis elegans | twk-16(syb2541[wrmScarlet::degron::twk-16]) X. | Made_by: Ravi Das|"wrmScarlet::degron tag inserted into the N-terminus of the endogenous twk-16 locus using CRISPR. wScarlet::TWK-16 expression in DVA and some neurons around the nerve ring. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987" | WBGene00006670(twk-16) | WBGene00006670(twk-16) | WB-STRAIN:WBStrain00051801 | WormBase (WB) | WB | unknown | 2026-09-05 04:57:15 | 0 | ||||
|
vha-14(luc138) vha-1(luc132) III; vha-11(luc130) vha-8(luc135) IV; vha-13(luc133) V; vha-12(luc139) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051767 | Caenorhabditis elegans | vha-14(luc138) vha-1(luc132) III; vha-11(luc130) vha-8(luc135) IV; vha-13(luc133) V; vha-12(luc139) X. | Made_by: Paula Gutirrez-Prez|"vha gain-of-function alleles created by replacing the miR-1 binding sites (ACATTCCA) in the 3' UTRs of the endogenous loci with a NotI (GCGGCCGC) restriction site. (vha-12 gain-of-function allele was created by replacing three miR-1 binding sites (ACATTCCA) with NotI (GCGGCCGC), BamHI (GGATCC), and EcoRI (GAATTC) restriction sites.) Referred as 6x-vhaNotI. Reference: Gutierrez-Prez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644." | WBGene00006910(vha-1)|WBGene00006917(vha-8)|WBGene00006920(vha-11)|WBGene00006921(vha-12)|WBGene00010130(vha-14)|WBGene00013025(vha-13) | WBGene00006910(vha-1), WBGene00006917(vha-8), WBGene00006920(vha-11), WBGene00006921(vha-12), WBGene00010130(vha-14), WBGene00013025(vha-13) | WB-STRAIN:WBStrain00051767 | WormBase (WB) | WB | unknown | 2026-09-05 04:57:14 | 0 | ||||
|
vha-8(luc135) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051766 | Caenorhabditis elegans | vha-8(luc135) IV. | Made_by: Paula Gutirrez-Prez|"vha-8 gain-of-function allele created by replacing the miR-1 binding site (ACATTCCA) in the 3' UTR of the endogenous locus with a NotI (GCGGCCGC) restriction site. Reference: Gutierrez-Prez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644." | WBGene00006917(vha-8) | WBGene00006917(vha-8) | WB-STRAIN:WBStrain00051766 | WormBase (WB) | WB | unknown | 2026-09-05 04:57:14 | 0 | ||||
|
nIs686 III; lin-15B&lin-15A(n765) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051805 | Caenorhabditis elegans | nIs686 III; lin-15B&lin-15A(n765) X. | nIs686 [gpa-16p::GCaMP3::unc-54 3' UTR + lin-15(+)] III. Expression of GCaMP in RIP, pharyngeal muscle (pm2, pm3, and dimly/occasionally in pm1), mc1 marginal cells, and other unidentified cells. Derived by gamma-irradiation of nEx2309 in parental strain MT23222 and out-crossed five times to MT8189 lin-15B&lin-15A(n765). Reference: Sando SR, et al. eLife 2021;10:e59341 doi: 10.7554/eLife.59341 | WBGene00023497(lin-15B)|WBGene00023498(lin-15A) | WBGene00023497(lin-15B), WBGene00023498(lin-15A) | WB-STRAIN:WBStrain00051805 | WormBase (WB) | WB | unknown | 2026-09-05 04:57:15 | 0 | ||||
|
nIs348 IV; lin-15AB(n765) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051804 | Caenorhabditis elegans | nIs348 IV; lin-15AB(n765) X. | nIs348 [ceh-28p::4XNLS::mCherry + lin-15(+)] IV. Reporter construct contains 2.4 kb of ceh-28 promoter. Reference: Hirose T, et al. Proc Natl Acad Sci. 2010 Aug 31;107(35):15479-84. PMID: 20713707 | WBGene00003004(lin-15) | WBGene00003004(lin-15) | WB-STRAIN:WBStrain00051804 | WormBase (WB) | WB | unknown | 2026-09-05 04:57:15 | 0 | ||||
|
vha-1(luc161) III/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051769 | Caenorhabditis elegans | vha-1(luc161) III/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). | Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP, arrested hT2 aneuploids, and non-GFP luc161 homozygotes (embryonic lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. vha-1(luc161) is a 454 bp deletion removing most of the coding sequence. Reference: Gutierrez-Prez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.|"Made_by: Paula Gutirrez-Prez" | WBGene00000254(bli-4)|WBGene00006910(vha-1) | WBGene00000254(bli-4), WBGene00006910(vha-1) | WB-STRAIN:WBStrain00051769 | WormBase (WB) | WB | unknown | 2026-09-05 04:57:14 | 0 | ||||
|
trp-4(mir35mir36[trp-4::gfp]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051802 | Caenorhabditis elegans | trp-4(mir35mir36[trp-4::gfp]) I. | GFP tag inserted into the N-terminus of the endogenous trp-4 locus using a two-step nested CRISPR method. The GFP signal is more prominent on the tip of the nose of the animals. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987|"Made_by: Ravi Das" | WBGene00006616(trp-4) | WBGene00006616(trp-4) | WB-STRAIN:WBStrain00051802 | WormBase (WB) | WB | unknown | 2026-09-05 04:57:15 | 0 | ||||
|
mod-5(vlc47[mod-5::T2A::mNeonGreen]) I. Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00051808 | Caenorhabditis elegans | mod-5(vlc47[mod-5::T2A::mNeonGreen]) I. | Made_by: Carlos Mora-Martnez|"mNeonGreen tag inserted into endogenous mod-5 locus. Upstream flanking sequence: AAATTATCGATAGTTCTCTTTTAGATCCAATcCAcACtCTcACaCCAGTT. Downstream flanking sequence: TAGATAATTCTTGGTGTACTGTTGGAAGTCAACGATCGATAGCCGTGCAC. Guide sequence: ACTGGAGTAAGTGTATGAAT. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334" | WBGene00003387(mod-5) | WBGene00003387(mod-5) | WB-STRAIN:WBStrain00051808 | WormBase (WB) | WB | unknown | 2026-09-05 04:57:15 | 2 | ||||
|
rrf-3(pk1426) II; lite-1(ce314) X; vlcEx1292. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051807 | Caenorhabditis elegans | rrf-3(pk1426) II; lite-1(ce314) X; vlcEx1292. | Made_by: ngela Jimeno|"vlcEx1292 [srh-142p::mCherry::SL2::GCaMP3 + unc-122p::RFP]. Maintain at or below 20C; sterile at 25C. Pick animals with RFP+ coelomocytes to maintain. ADF-specific expression of GCaMP3. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334" | WBGene00001803(lite-1)|WBGene00004510(rrf-3) | WBGene00001803(lite-1), WBGene00004510(rrf-3) | WB-STRAIN:WBStrain00051807 | WormBase (WB) | WB | unknown | 2026-09-05 04:57:15 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
