Organisms   Select Another Resource Report Type

http://www.wormbase.org/db/get?name=WBStrain00051773

Source Database: WormBase (WB)
Affected Genes: WBGene00015776(dct-1)
Genomic Alteration: WBGene00015776(dct-1)
Availability: unknown
Source References: EMPTY
Synonyms: dct-1(luc194) X.
Notes: CRISPR/Cas9-engineered deletion removes the entire dct-1 coding sequence. Homozygote mutant animals are viable and have normal morphology. Outer left sequence: gtttcagagacgggtctttcctaaca Outer right sequence: ttccaaacaaaaattttaacgttcgactta sgRNA1: ACAGCAGACGGAGCAGTCAT sgRNA2: GTACAGTGAAATGAGGTAAG Reference: Gutierrez-Prez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.|"CRISPR/Cas9-engineered deletion removes the entire dct-t coding sequence. Homozygote mutant animals are viable and have normal morphology. Outer left sequence: gtttcagagacgggtctttcctaaca Outer right sequence: ttccaaacaaaaattttaacgttcgactta sgRNA1: ACAGCAGACGGAGCAGTCAT sgRNA2: GTACAGTGAAATGAGGTAAG Reference: Gutierrez-Prez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644."|"Made_by: Paula Gutirrez-Prez"

Proper citation: RRID:WB-STRAIN:WBStrain00051773 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051772

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: oxIs322 II; unc-119(ed3) III; lucEx1311.
Notes: Made_by: Paula Gutirrez-Prez|"oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + Cbr-unc-119(+)]. lucEx1311 (myo-3p::R2pH::LAMP1::3xFLAG::unc-54 3UTR + ttx-3p::mCherry). Pick mCherry+ to maintain. Reference: Gutierrez-Perez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644."

Proper citation: RRID:WB-STRAIN:WBStrain00051772 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051779

Source Database: WormBase (WB)
Affected Genes: WBGene00000898(daf-2)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00000898(daf-2), WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III; ieSi38 IV.
Notes: ieSi38 [sun-1p::TIR1::mRuby::sun-1 3' UTR + Cbr-unc-119(+)] IV. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. A single copy transgene was inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the germ line.|"Made_by: Yan-Ping Zhang, Wen-Hong Zhang"

Proper citation: RRID:WB-STRAIN:WBStrain00051779 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051778

Source Database: WormBase (WB)
Affected Genes: WBGene00000898(daf-2)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00000898(daf-2), WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: ieSi61 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III.
Notes: ieSi61 [ges-1p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. A single copy transgene was inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the intestine. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the intestine. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https:|"Made_by: Yan-Ping Zhang, Wen-Hong Zhang"

Proper citation: RRID:WB-STRAIN:WBStrain00051778 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051777

Source Database: WormBase (WB)
Affected Genes: WBGene00000898(daf-2)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00000898(daf-2), WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: hqSi8 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III.
Notes: hqSi8 [rgef-1p::TIR1::mRuby::unc-54 3UTR+Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi8 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the rgef-1 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the neurons. hqSi8 previously known as hq373. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https:|"Made_by: Yan-Ping Zhang, Wen-Hong Zhang"

Proper citation: RRID:WB-STRAIN:WBStrain00051777 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051815

Source Database: WormBase (WB)
Affected Genes: WBGene00016421(cdc-7)
Genomic Alteration: WBGene00016421(cdc-7)
Availability: unknown
Source References: EMPTY
Synonyms: cdc-7(knu709) I.
Notes: CRISPR-engineered deletion removing entire cdc-7 gene. Out-crossed 3x to N2. Reference: Currey HN & Liachko NF. 2019. A CRISPR/Cas9-generated cdc-7 loss of function mutation does not cause temperature-dependent fertility defects. microPublication Biology. Jan 3;2019:10.17912.

Proper citation: RRID:WB-STRAIN:WBStrain00051815 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051813

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: zdIs13 IV; vlcEx1290.
Notes: zdIs13 [tph-1p::GFP] IV. vlcEx1288 [hsp16.2p::lag-1D(cDNA) + ttx-3::mCherry + rol-6(su1006)]. Pick Rollers to maintain. Heatshock induces expression of LAG-1D. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334

Proper citation: RRID:WB-STRAIN:WBStrain00051813 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051818

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38302462
Synonyms: jsSi1669 IV.
Notes: jsSi1669 [loxP::mex-5p::FLP::D5::sl2::mNG::glh-2::3 rpl-28p::FRT::GFP::his-58::FRT3] IV. Single component RMCE landing site on Chr IV adjacent to the site of the commonly used ttTi10882 MosSCi insertion site.

Proper citation: RRID:WB-STRAIN:WBStrain00051818 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051817

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:39652010
Synonyms: jsSi1579 II; bqSi711 IV.
Notes: jsSi1579 [loxP::rpl-28p::FRT::GFP::his-58 FRT3] II. bqSi711 [mex-5p::FLP::SL2::mNG + unc-119(+)] IV. Dual component RMCE landing site on Chr II adjacent to the site of the commonly used ttTi5605 MosSCi insertion site.

Proper citation: RRID:WB-STRAIN:WBStrain00051817 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051762

Source Database: WormBase (WB)
Affected Genes: WBGene00006920(vha-11)
Genomic Alteration: WBGene00006920(vha-11)
Availability: unknown
Source References: EMPTY
Synonyms: vha-11(luc130) IV.
Notes: Made_by: Paula Gutirrez-Prez|"vha-11 gain-of-function allele created by replacing the miR-1 binding site (ACATTCCA) in the 3' UTR of the endogenous locus with a NotI (GCGGCCGC) restriction site. Reference: Gutierrez-Prez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644."

Proper citation: RRID:WB-STRAIN:WBStrain00051762 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051761

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: lucEx421.
Notes: lucEx421 [mir-4813p::myr::GFP::unc-54 3UTR + ttx-3p::mCherry]. Pick mCherry+ animals to maintain. Reporter contains 1kb upstream mir-4813 promoter sequence and 1kb unc-54 3UTR downstream sequence. Provides a marker for pharyngeal muscle cell-cell fusion. Reference: Gutierrez-Prez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.|"Made_by: Thomas Steinacker"

Proper citation: RRID:WB-STRAIN:WBStrain00051761 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051801

Source Database: WormBase (WB)
Affected Genes: WBGene00006670(twk-16)
Genomic Alteration: WBGene00006670(twk-16)
Availability: unknown
Source References: EMPTY
Synonyms: twk-16(syb2541[wrmScarlet::degron::twk-16]) X.
Notes: Made_by: Ravi Das|"wrmScarlet::degron tag inserted into the N-terminus of the endogenous twk-16 locus using CRISPR. wScarlet::TWK-16 expression in DVA and some neurons around the nerve ring. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987"

Proper citation: RRID:WB-STRAIN:WBStrain00051801 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051767

Source Database: WormBase (WB)
Affected Genes: WBGene00006910(vha-1)|WBGene00006917(vha-8)|WBGene00006920(vha-11)|WBGene00006921(vha-12)|WBGene00010130(vha-14)|WBGene00013025(vha-13)
Genomic Alteration: WBGene00006910(vha-1), WBGene00006917(vha-8), WBGene00006920(vha-11), WBGene00006921(vha-12), WBGene00010130(vha-14), WBGene00013025(vha-13)
Availability: unknown
Source References: EMPTY
Synonyms: vha-14(luc138) vha-1(luc132) III; vha-11(luc130) vha-8(luc135) IV; vha-13(luc133) V; vha-12(luc139) X.
Notes: Made_by: Paula Gutirrez-Prez|"vha gain-of-function alleles created by replacing the miR-1 binding sites (ACATTCCA) in the 3' UTRs of the endogenous loci with a NotI (GCGGCCGC) restriction site. (vha-12 gain-of-function allele was created by replacing three miR-1 binding sites (ACATTCCA) with NotI (GCGGCCGC), BamHI (GGATCC), and EcoRI (GAATTC) restriction sites.) Referred as 6x-vhaNotI. Reference: Gutierrez-Prez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644."

Proper citation: RRID:WB-STRAIN:WBStrain00051767 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051766

Source Database: WormBase (WB)
Affected Genes: WBGene00006917(vha-8)
Genomic Alteration: WBGene00006917(vha-8)
Availability: unknown
Source References: EMPTY
Synonyms: vha-8(luc135) IV.
Notes: Made_by: Paula Gutirrez-Prez|"vha-8 gain-of-function allele created by replacing the miR-1 binding site (ACATTCCA) in the 3' UTR of the endogenous locus with a NotI (GCGGCCGC) restriction site. Reference: Gutierrez-Prez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644."

Proper citation: RRID:WB-STRAIN:WBStrain00051766 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051805

Source Database: WormBase (WB)
Affected Genes: WBGene00023497(lin-15B)|WBGene00023498(lin-15A)
Genomic Alteration: WBGene00023497(lin-15B), WBGene00023498(lin-15A)
Availability: unknown
Source References: EMPTY
Synonyms: nIs686 III; lin-15B&lin-15A(n765) X.
Notes: nIs686 [gpa-16p::GCaMP3::unc-54 3' UTR + lin-15(+)] III. Expression of GCaMP in RIP, pharyngeal muscle (pm2, pm3, and dimly/occasionally in pm1), mc1 marginal cells, and other unidentified cells. Derived by gamma-irradiation of nEx2309 in parental strain MT23222 and out-crossed five times to MT8189 lin-15B&lin-15A(n765). Reference: Sando SR, et al. eLife 2021;10:e59341 doi: 10.7554/eLife.59341

Proper citation: RRID:WB-STRAIN:WBStrain00051805 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051804

Source Database: WormBase (WB)
Affected Genes: WBGene00003004(lin-15)
Genomic Alteration: WBGene00003004(lin-15)
Availability: unknown
Source References: EMPTY
Synonyms: nIs348 IV; lin-15AB(n765) X.
Notes: nIs348 [ceh-28p::4XNLS::mCherry + lin-15(+)] IV. Reporter construct contains 2.4 kb of ceh-28 promoter. Reference: Hirose T, et al. Proc Natl Acad Sci. 2010 Aug 31;107(35):15479-84. PMID: 20713707

Proper citation: RRID:WB-STRAIN:WBStrain00051804 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051769

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00006910(vha-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00006910(vha-1)
Availability: unknown
Source References: EMPTY
Synonyms: vha-1(luc161) III/hT2[bli-4(e937) let-?(q782) qIs48] (I;III).
Notes: Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP, arrested hT2 aneuploids, and non-GFP luc161 homozygotes (embryonic lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. vha-1(luc161) is a 454 bp deletion removing most of the coding sequence. Reference: Gutierrez-Prez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.|"Made_by: Paula Gutirrez-Prez"

Proper citation: RRID:WB-STRAIN:WBStrain00051769 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051802

Source Database: WormBase (WB)
Affected Genes: WBGene00006616(trp-4)
Genomic Alteration: WBGene00006616(trp-4)
Availability: unknown
Source References: EMPTY
Synonyms: trp-4(mir35mir36[trp-4::gfp]) I.
Notes: GFP tag inserted into the N-terminus of the endogenous trp-4 locus using a two-step nested CRISPR method. The GFP signal is more prominent on the tip of the nose of the animals. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987|"Made_by: Ravi Das"

Proper citation: RRID:WB-STRAIN:WBStrain00051802 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051808

Source Database: WormBase (WB)
Affected Genes: WBGene00003387(mod-5)
Genomic Alteration: WBGene00003387(mod-5)
Availability: unknown
Source References: EMPTY
Synonyms: mod-5(vlc47[mod-5::T2A::mNeonGreen]) I.
Notes: Made_by: Carlos Mora-Martnez|"mNeonGreen tag inserted into endogenous mod-5 locus. Upstream flanking sequence: AAATTATCGATAGTTCTCTTTTAGATCCAATcCAcACtCTcACaCCAGTT. Downstream flanking sequence: TAGATAATTCTTGGTGTACTGTTGGAAGTCAACGATCGATAGCCGTGCAC. Guide sequence: ACTGGAGTAAGTGTATGAAT. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334"

Proper citation: RRID:WB-STRAIN:WBStrain00051808 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051807

Source Database: WormBase (WB)
Affected Genes: WBGene00001803(lite-1)|WBGene00004510(rrf-3)
Genomic Alteration: WBGene00001803(lite-1), WBGene00004510(rrf-3)
Availability: unknown
Source References: EMPTY
Synonyms: rrf-3(pk1426) II; lite-1(ce314) X; vlcEx1292.
Notes: Made_by: ngela Jimeno|"vlcEx1292 [srh-142p::mCherry::SL2::GCaMP3 + unc-122p::RFP]. Maintain at or below 20C; sterile at 25C. Pick animals with RFP+ coelomocytes to maintain. ADF-specific expression of GCaMP3. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334"

Proper citation: RRID:WB-STRAIN:WBStrain00051807 Copy   

•   Source: Integrated Animals