Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
gld-3(ust495[gld-3::GFP::3xFlag]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063163 | Caenorhabditis elegans | gld-3(ust495[gld-3::GFP::3xFlag]) II. | GFP::3xFlag inserted into endogenous gld-3 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.|"Made_by: Xiaona Huang" | WBGene00001597(gld-3) | WBGene00001597(gld-3) | WB-STRAIN:WBStrain00063163 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:50 | 0 | ||||
|
pgl-2(ust515[3xFlag::GFP::pgl-2]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063166 | Caenorhabditis elegans | pgl-2(ust515[3xFlag::GFP::pgl-2]) III. | 3xFlag::GFP inserted into endogenous pgl-2 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.|"Made_by: Xiaona Huang" | WBGene00003993(pgl-2) | WBGene00003993(pgl-2) | WB-STRAIN:WBStrain00063166 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:50 | 0 | ||||
|
pid-4(ust516[pid-4::GFP::3xFlag]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063167 | Caenorhabditis elegans | pid-4(ust516[pid-4::GFP::3xFlag]) I. | GFP::3xFlag inserted into endogenous pid-4 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.|"Made_by: Xiaona Huang" | WBGene00021014(pid-4) | WBGene00021014(pid-4) | WB-STRAIN:WBStrain00063167 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:50 | 0 | ||||
|
pid-5(ust517[pid-5::GFP::3xFlag]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063168 | Caenorhabditis elegans | pid-5(ust517[pid-5::GFP::3xFlag]) V. | GFP::3xFlag inserted into endogenous pid-5 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.|"Made_by: Xiaona Huang" | WBGene00021555(pid-5) | WBGene00021555(pid-5) | WB-STRAIN:WBStrain00063168 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:51 | 0 | ||||
|
hmp-1(jc58[hmp-1::mScarlet-1 + Lox511]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063208 | Caenorhabditis elegans | hmp-1(jc58[hmp-1::mScarlet-1 + Lox511]) V. | Made_by: Joel M. Serre|"mScarlet tag inserted into endogenous hmp-1 locus by CRISPR/Cas9 genome editing. Reference: Serre JM, et al. PLoS Genet. 2023 Mar 3;19(3):e1010507. doi: 10.1371/journal.pgen.1010507. PMID: 36867663." | WBGene00001978(hmp-1) | WBGene00001978(hmp-1) | WB-STRAIN:WBStrain00063208 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:51 | 0 | ||||
|
zjuEx2429. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063205 | Caenorhabditis elegans | zjuEx2429. | Made_by: Jingxiu Xu|"zjuEx2429 [col-19p::BFP::8xMS2 + semo-1p::MCP::24Suntag + col-19p::scFv::sfGFP + myo-2p::GFP]. Pick GFP+ (pharynx) animals to maintain. MS2-based signal Amplification with Suntag System (MASS). Enhanced MS2-based single-molecule RNA imaging system utilizes Suntag signal amplifier. Suntag is a 19 amino acid protein tag that binds to its specific single-chain variable fragment (scFv) antibody. When all the required elements of the MASS (MS2, MCP, 24xSuntag, and scFv antibodies) are present, bright GFP foci will mark the tagged RNA. Reference: Hu Y, et al. eLife. 2023 Mar 3;12:e82178. doi: 10.7554/eLife.82178. PMID: 36867026." | WB-STRAIN:WBStrain00063205 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:51 | 0 | ||||||
|
spn-4(ust434[spn-4::GFP::3xFlag]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063151 | Caenorhabditis elegans | spn-4(ust434[spn-4::GFP::3xFlag]) V. | GFP::3xFlag inserted into endogenous spn-4 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.|"Made_by: Xiaona Huang" | WBGene00004984(spn-4) | WBGene00004984(spn-4) | WB-STRAIN:WBStrain00063151 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:50 | 0 | ||||
|
mina-1(ust433[mina-1::GFP::3xFlag]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063150 | Caenorhabditis elegans | mina-1(ust433[mina-1::GFP::3xFlag]) I. | GFP::3xFlag inserted into endogenous mina-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.|"Made_by: Xiaona Huang" | WBGene00008061(mina-1) | WBGene00008061(mina-1) | WB-STRAIN:WBStrain00063150 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:50 | 0 | ||||
|
gld-1(ust451[gld-1::GFP::3xFlag]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063155 | Caenorhabditis elegans | gld-1(ust451[gld-1::GFP::3xFlag]) I. | GFP::3xFlag inserted into endogenous gld-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.|"Made_by: Xiaona Huang" | WBGene00001595(gld-1) | WBGene00001595(gld-1) | WB-STRAIN:WBStrain00063155 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:50 | 0 | ||||
|
mip-2(ust450[mip-2::GFP::3xFlag]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063154 | Caenorhabditis elegans | mip-2(ust450[mip-2::GFP::3xFlag]) V. | GFP::3xFlag inserted into endogenous mip-2 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.|"Made_by: Xiaona Huang" | WBGene00010281(mip-2) | WBGene00010281(mip-2) | WB-STRAIN:WBStrain00063154 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:50 | 0 | ||||
|
glh-4(ust449[glh-4::GFP::3xFlag]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063159 | Caenorhabditis elegans | glh-4(ust449[glh-4::GFP::3xFlag]) I. | GFP::3xFlag inserted into endogenous glh-4 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.|"Made_by: Xiaona Huang" | WBGene00001601(glh-4) | WBGene00001601(glh-4) | WB-STRAIN:WBStrain00063159 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:50 | 0 | ||||
|
ddx-19(ust374[ddx-19::mCherry]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063140 | Caenorhabditis elegans | ddx-19(ust374[ddx-19::mCherry]) II. | mCherry inserted into endogenous ddx-19 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. | WBGene00011580(ddx-19) | WBGene00011580(ddx-19) | WB-STRAIN:WBStrain00063140 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:50 | 0 | ||||
|
henn-1(ust413[henn-1::GFP::3xFlag]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063148 | Caenorhabditis elegans | henn-1(ust413[henn-1::GFP::3xFlag]) III. | GFP::3xFlag inserted into endogenous henn-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.|"Made_by: Xiaona Huang" | WBGene00015349(henn-1) | WBGene00015349(henn-1) | WB-STRAIN:WBStrain00063148 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:50 | 0 | ||||
|
adah-1(hd7105 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP])/tmC25 [unc-5(tm9708)] IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063298 | Caenorhabditis elegans | adah-1(hd7105 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP])/tmC25 [unc-5(tm9708)] IV. | Made_by: VH KO group|"Maintain by picking wild-type GFP+. Apparent homozygous lethal or sterile deletion balanced tmC25. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+ and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Derived from parental strains VH7105 and FX30257. hd7105 is a deletion of 4581 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006745(unc-5)|WBGene00006789(unc-54)|WBGene00015551(adah-1) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006745(unc-5), WBGene00006789(unc-54), WBGene00015551(adah-1) | WB-STRAIN:WBStrain00063298 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:52 | 0 | ||||
|
F56B3.6(hd7168[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063331 | Caenorhabditis elegans | F56B3.6(hd7168[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | Homozygous viable. Deletion of 2190 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCAACTTCTGGACAACCGGCAGAAACGCCA; Right flanking sequence: GTAGGCACAAAGAAGGCGTAGGCCTCCTGG. sgRNA #1: TGGCGTTTCAGAGCTGCACG; sgRNA #2: AAAGCCAATTGTCTGAAAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063331 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:53 | 0 | ||||
|
mdh-1(hd7169[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063332 | Caenorhabditis elegans | mdh-1(hd7169[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. | Homozygous viable. Deletion of 969 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTAAGACCTTGAACAATCTTCCATTCGCCA; Right flanking sequence: CGGACATTCTGAAAATTTAGCAATTTACAC. sgRNA #1: TTCCCAGTTACCATCGAGGG; sgRNA #2: GACCAAAACGCGAAGTGGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00018491(mdh-1) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00018491(mdh-1) | WB-STRAIN:WBStrain00063332 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:53 | 0 | ||||
|
F46F11.10(hd7096 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063297 | Caenorhabditis elegans | F46F11.10(hd7096 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. | Made_by: VH KO group|"umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7096 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VH7096 and CGC92. hd7096 is a 667 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00000254(bli-4)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00000254(bli-4), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063297 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:52 | 0 | ||||
|
+/nT1 [umnls49] IV; mrps-2 (hd7170 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP])/nT1 V Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063335 | Caenorhabditis elegans | +/nT1 [umnls49] IV; mrps-2 (hd7170 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP])/nT1 V | Made_by: VH KO group|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7170 and CGC63. hd7170 is a 966 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CAGAAAGAGCCTTCTCGACACGATTTTCCG; Right flanking sequence: TTCGAAAGTGGCAATCAGGAACTCTAACGA. sgRNA #1: AATGGTTACCTGCTGCGACG; sgRNA #2: GGTTGGGCAATACTCTCACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00020718(mrps-2) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00020718(mrps-2) | WB-STRAIN:WBStrain00063335 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:53 | 0 | ||||
|
atg-5(hd7174[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063336 | Caenorhabditis elegans | atg-5(hd7174[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. | Homozygous viable. Deletion of 6488 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTAAAGCCGAGATTACAAAGAATATGATGA; Right flanking sequence: GACCTTTTATAACTATTCACCCATACTAAT. sgRNA #1: AAGACGAGTCGGCACAGTTG; sgRNA #2: GTGAAGTTGTTATTGTACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00022152(atg-5) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00022152(atg-5) | WB-STRAIN:WBStrain00063336 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:53 | 0 | ||||
|
cyp-33C8(hd7171[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063333 | Caenorhabditis elegans | cyp-33C8(hd7171[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. | Homozygous viable. Deletion of 2415 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAACTTTCTCGGAGTTATCCCCTTCGATTT; Right flanking sequence: GGGAGAGGAGTAGGTCCCGGTGGTAAATTT. sgRNA #1: GTCGAGCGATGGAAGACCGG; sgRNA #2: GGAGAGTATTGCCGAACAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063333 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:53 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
