Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Norway

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search
Reset search
On page 29 showing 561 ~ 580 out of 64,152 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

http://www.wormbase.org/db/get?name=WBStrain00063130

Source Database: WormBase (WB)
Affected Genes: WBGene00002275(lem-2)
Genomic Alteration: WBGene00002275(lem-2)
Availability: unknown
Source References: EMPTY
Synonyms: lem-2(sbw5[lem-2::mNeonGreen]) II.
Notes: Made_by: Sarah Barger|"mNeonGreen tag inserted at C-terminus of endogenous lem-2 locus using self-exising drug selection casette method (described by Hastie et al., 2019 J Microbiol Biol Educ). Reference: Barger SR, et al. J Cell Sci 1 November 2023; 136 (21): jcs261385. doi: https:"

Proper citation: RRID:WB-STRAIN:WBStrain00063130 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063094

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00004267(rab-3)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00004267(rab-3)
Availability: unknown
Source References: EMPTY
Synonyms: dpy-10(cn64) rab-3(ftw79) II.
Notes: rab-3(ftw79[rab-3::SL2::LoxP::GFP::NLS::3'UTR::Abeta(inv)::sigPep(inv)::T2A(inv)::wrmScarlet11(inv)::LoxP(inv)]) II. Modified endogenous rab-3 locus co-expresses stochastic, switchable cassette by trans-splicing using CRISPR-Cas9. Green fluorescence visible in neurons by dissection fluorescence microscopy. Inverted LoxP sites flank the GFP-NLS and inverted wrmScarlet11::T2A::signalPeptide::Abeta insert. Please contact Ryan Littlefield prior to publishing work using this strain.

Proper citation: RRID:WB-STRAIN:WBStrain00063094 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063095

Source Database: WormBase (WB)
Affected Genes: WBGene00003370(mlc-2)
Genomic Alteration: WBGene00003370(mlc-2)
Availability: unknown
Source References: EMPTY
Synonyms: mlc-2(ftw80[LifeAct::wrmScarlet::SL2::mlc-2]) X.
Notes: Endogenous mlc-2 locus co-expresses LifeAct peptide fused to wrmScarlet. Myosin light chain is untagged. Bright red fluorescence in all muscles is visible by dissection fluorescence microscopy. Broad bands of fluorescence are visible in body wall muscle by confocal microscopy. Please contact Ryan Littlefield prior to publishing work with this strain.

Proper citation: RRID:WB-STRAIN:WBStrain00063095 Copy   

    • RRID:WB-STRAIN:WBStrain00063133

http://www.wormbase.org/db/get?name=WBStrain00063133

Source Database: WormBase (WB)
Affected Genes: WBGene00002275(lem-2)
Genomic Alteration: WBGene00002275(lem-2)
Availability: unknown
Source References: EMPTY
Synonyms: lem-2(sbw20) II.
Notes: CRISPR/Cas9-engineered deletion of entire lem-2 locus. Reference: Barger SR, et al. J Cell Sci 1 November 2023; 136 (21): jcs261385. doi: https:|"Made_by: Sarah Barger"

Proper citation: RRID:WB-STRAIN:WBStrain00063133 Copy   

    • RRID:WB-STRAIN:WBStrain00063134

http://www.wormbase.org/db/get?name=WBStrain00063134

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: ustSi268 I.
Notes: ustSi268 [mex-5p::tagrfp::elli-1::tbb-2 3'UTR] I. Inserted into LG I (-5.51 cM) locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. Reference: Chen X, et al. Nat Commun. 2024 Jul 10;15(1):5799. doi: 10.1038/s41467-024-50027-3. PMID: 38987544.

Proper citation: RRID:WB-STRAIN:WBStrain00063134 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063131

Source Database: WormBase (WB)
Affected Genes: WBGene00000235(baf-1)
Genomic Alteration: WBGene00000235(baf-1)
Availability: unknown
Source References: EMPTY
Synonyms: baf-1(sbw7[mNeonGreen::baf-1]) III.
Notes: Made_by: Sarah Barger|"mNeonGreen tag inserted at N-terminus of endogenous baf-1 locus using self-excising drug selection cassette method (described by Dickinson, et al. 2015, Genetics). Reference: Barger SR, et al. J Cell Sci 1 November 2023; 136 (21): jcs261385. doi: https:"

Proper citation: RRID:WB-STRAIN:WBStrain00063131 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063099

Source Database: WormBase (WB)
Affected Genes: WBGene00006585(tni-3)
Genomic Alteration: WBGene00006585(tni-3)
Availability: unknown
Source References: EMPTY
Synonyms: tni-3(ftw13[tni-3::mCherry::SL2::GFP::NLS]) V.
Notes: Endogenous tni-3 locus tagged with mCherry using CRISPR/Cas9. GFP-nls coexpressed from the endogenous promoter using SL2 trans-splicing. Visible using fluorescent dissecting microscopes. WT movement and behavior. Please contact Ryan Littlefield prior to publishing work using this strain.|"Made_by: Ryan Littlefield & Tammie Ward"

Proper citation: RRID:WB-STRAIN:WBStrain00063099 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063138

Source Database: WormBase (WB)
Affected Genes: WBGene00001402(fbf-2)
Genomic Alteration: WBGene00001402(fbf-2)
Availability: unknown
Source References: EMPTY
Synonyms: fbf-2(ust337[fbf-2::GFP::3xFlag]) II.
Notes: GFP::3xFlag inserted into endogenous fbf-2 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.|"Made_by: Xiaona Huang"

Proper citation: RRID:WB-STRAIN:WBStrain00063138 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063086

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: ZK1240.6(ve999[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Notes: Homozygous viable. Deletion of 398 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCCTGAAAATTAATATTAGGTACCTGACCT ; Right flanking sequence: ACTTGGAAATTGGAGAGCAAGTAAAAGTTA. ZK1240.6 sgRNA A: ACTTCAGAACCTGATATGCA; ZK1240.6 sgRNA B: TAGTCGAGTTATTCGTGCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00063086 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063083

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: Y25C1A.8(ve996[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Notes: Homozygous viable. Deletion of 3675 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CACTTTCTGGGCAAGAGCATTCACCGCCCG ; Right flanking sequence: CGGTTTCGCTGAAAATCGATAATTTTTGGG. Y25C1A.8 sgRNA A: CAGATGCTCATGCTCATGCT; Y25C1A.8 sgRNA B: CCAATTTTGCTTTTCGCGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00063083 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063122

Source Database: WormBase (WB)
Affected Genes: WBGene00006538(tbb-4)
Genomic Alteration: WBGene00006538(tbb-4)
Availability: unknown
Source References: EMPTY
Synonyms: tbb-4(tj74[gfp::TEV::3xFLAG::tbb-4]) X.
Notes: GFP::TEV::3xFLAG tag inserted into the endogenous tbb-4 locus. Reference: Nishida K, et al. Cell Struct. Funct. 2021 Jun 30;46(1):51-64. PMID: 33967119.

Proper citation: RRID:WB-STRAIN:WBStrain00063122 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063123

Source Database: WormBase (WB)
Affected Genes: WBGene00003171(mec-7)
Genomic Alteration: WBGene00003171(mec-7)
Availability: unknown
Source References: EMPTY
Synonyms: mec-7(tj77[gfp::TEV::3xFLAG::mec-7]) X.
Notes: GFP::TEV::3xFLAG tag inserted into the endogenous mec-7 locus. Reference: Nishida K, et al. Cell Struct. Funct. 2021 Jun 30;46(1):51-64. PMID: 33967119.

Proper citation: RRID:WB-STRAIN:WBStrain00063123 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063120

Source Database: WormBase (WB)
Affected Genes: WBGene00006533(tba-7)
Genomic Alteration: WBGene00006533(tba-7)
Availability: unknown
Source References: EMPTY
Synonyms: tba-7(tj66[gfp::TEV::3xFLAG::tba-7]) III.
Notes: GFP::TEV::3xFLAG tag inserted into the endogenous tba-7 locus. Reference: Nishida K, et al. Cell Struct. Funct. 2021 Jun 30;46(1):51-64. PMID: 33967119.|"Made_by: Hiroyuki Obinata"

Proper citation: RRID:WB-STRAIN:WBStrain00063120 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063126

Source Database: WormBase (WB)
Affected Genes: WBGene00006531(tba-5)
Genomic Alteration: WBGene00006531(tba-5)
Availability: unknown
Source References: EMPTY
Synonyms: tba-5(tj102[gfp::TEV::3xFLAG::tba-5]) I.
Notes: GFP::TEV::3xFLAG tag inserted into the endogenous tba-5 locus. Reference: Nishida K, et al. Cell Struct. Funct. 2021 Jun 30;46(1):51-64. PMID: 33967119.|"Made_by: Shizuka Onodera"

Proper citation: RRID:WB-STRAIN:WBStrain00063126 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063125

Source Database: WormBase (WB)
Affected Genes: WBGene00006535(tba-9)
Genomic Alteration: WBGene00006535(tba-9)
Availability: unknown
Source References: EMPTY
Synonyms: tba-9(tj100[gfp::TEV::3xFLAG::tba-9]) X.
Notes: GFP::TEV::3xFLAG tag inserted into the endogenous tba-9 locus. Reference: Nishida K, et al. Cell Struct. Funct. 2021 Jun 30;46(1):51-64. PMID: 33967119.|"Made_by: Hiroyuki Obinata"

Proper citation: RRID:WB-STRAIN:WBStrain00063125 Copy   

    • RRID:WB-STRAIN:WBStrain00063195

http://www.wormbase.org/db/get?name=WBStrain00063195

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: ustSi64 II.
Notes: ustSi64 [wago-3p::3xFlag::GFP::wago-3::wago-3 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 of parental strain EG4322. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.

Proper citation: RRID:WB-STRAIN:WBStrain00063195 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063199

Source Database: WormBase (WB)
Affected Genes: WBGene00002061(ife-3)
Genomic Alteration: WBGene00002061(ife-3)
Availability: unknown
Source References: EMPTY
Synonyms: ife-3(ust639[ife-3::GFP::3xFlag]) V.
Notes: GFP::3xFlag inserted into endogenous ife-3 locus using CRISPR/CAS9 engineering. Reference: Zeng C, et al. Cell Rep. 2019 Jun 18;27(12):3561-3572.e3. doi: 10.1016/j.celrep.2019.05.076. PMID: 31216475.|"Made_by: Chenmimg Zeng"

Proper citation: RRID:WB-STRAIN:WBStrain00063199 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063237

Source Database: WormBase (WB)
Affected Genes: WBGene00006364(syd-2)|WBGene00006750(unc-10)
Genomic Alteration: WBGene00006364(syd-2), WBGene00006750(unc-10)
Availability: unknown
Source References: EMPTY
Synonyms: wyIs891 III; unc-10(wy1235[unc-10::FLPon::mScarlet-I]) syd-2(wy1323) X.
Notes: Made_by: Nathan McDonald|"wyIs891 [unc-86p::FLP + odr-1p::RFP] III. FLPon::mScarlet-I tag inserted into endogenous unc-10 locus. GFP tag inserted into endogenous syd-2 locus with (517-836) region replaced by worm-optimized FUS 1-163. Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945."

Proper citation: RRID:WB-STRAIN:WBStrain00063237 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063234

Source Database: WormBase (WB)
Affected Genes: WBGene00006364(syd-2)|WBGene00006750(unc-10)
Genomic Alteration: WBGene00006364(syd-2), WBGene00006750(unc-10)
Availability: unknown
Source References: EMPTY
Synonyms: wyIs891 III; unc-10(wy1235[unc-10::FLPon::mScarlet-I]) syd-2(wy5) X.
Notes: Made_by: Nathan McDonald|"wyIs891 [unc-86p::FLP + odr-1p::RFP] III. FLPon::mScarlet-I tag inserted into endogenous unc-10 locus. Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945."

Proper citation: RRID:WB-STRAIN:WBStrain00063234 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063235

Source Database: WormBase (WB)
Affected Genes: WBGene00004267(rab-3)|WBGene00006364(syd-2)
Genomic Alteration: WBGene00004267(rab-3), WBGene00006364(syd-2)
Availability: unknown
Source References: EMPTY
Synonyms: rab-3(wy1332[mScarlet-I::FLPon::rab-3B]) II; wyIs891 III; syd-2(wy1052[GFP::syd-2]) X.
Notes: Made_by: Nathan McDonald|"wyIs891 [unc-86p::FLP + odr-1p::RFP] III. mScarlet-I::FLPon tag inserted into endogenous rab-3 locus specifically tagging isoform B, which is most abundant in neurons. GFP tag inserted into N-terminus of endogenous syd-2 locus. Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945."

Proper citation: RRID:WB-STRAIN:WBStrain00063235 Copy   

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

Join NIH's “It's About Time: Temporal Reasoning in Biomedical Knowledge Graphs Challenge”

dkNET community events and announcements in September, 2026

dkNET community events and announcements in August, 2026

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch