Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 29 showing 561 ~ 580 out of 1,464 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:RGD_598092601

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092601

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-28)
Alternate IDs: 598092601
Notes: A 7-base deletion was introduced into the first exon of the NADPH oxidase 2 (Nox2)(official symbol:Cybb) gene of F344/DuCrj rats by CRISPR/Cas9. They were then backcrossed to F344/N (Japan SLC, Inc.). National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_598092601 Copy   


  • RRID:RGD_598092577

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092577

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-27)
Alternate IDs: 598092577
Notes: The Hspa8 mutation (c.284T>A) in the KK rat (NBRP Rat No. 0890) was inserted into the F344/Jcl. Knocking in of the mutant allele was performed by lsODN-mediated knock-in with the CRISPR-Cas9 system. The gRNA and PAM sequences are gtgccacaagctattaaatatatgg (PAM: tgg) and ccatttatggatgggctctctccc (PAM: cca). In KI rats, each PAM sequence is replaced by a silent mutation. Two lines were obtained from founder rats. In line 2, there are two SNPs in the intron where the upstream gRNA, but this is not related to the phenotype. This strain was produced with the support of the AdAMS (Advanced Animal Model Support). National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_598092577 Copy   


  • RRID:RGD_598092574

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092574

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-27)
Alternate IDs: 598092574
Notes: The Hspa8 mutation (c.284T>A) in the KK rat (NBRP Rat No. 0890)(RGD:598092575) was inserted into the F344/Jcl. Knocking in of the mutant allele was performed by lsODN-mediated knock-in with the CRISPR-Cas9 system. The gRNA and PAM sequences are gtgccacaagctattaaatatatgg (PAM: tgg) and ccatttatggatgggctctctccc (PAM: cca). In KI rats, each PAM sequence is replaced by a silent mutation. Two lines were obtained from founder rats. In line 1, there is one SNP in the intron where the upstream gRNA, but this is not related to the phenotype. This strain was produced with the support of the AdAMS (Advanced Animal Model Support). National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_598092574 Copy   


  • RRID:RGD_598130079

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598130079

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2025-04-15)
Alternate IDs: 598130079
Notes: The CRISPR/Cas9 system was used to introduce an 8-bp deletion in exon 1 of the Col7a1 gene of one-cell Lew/Crl rat embryos. The strain is deposited with RRRC (Rat Resource and Research Center)

Proper citation: RRID:RGD_598130079 Copy   


  • RRID:RGD_401938598

    This resource has 1+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401938598

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2023-12-12)
Alternate IDs: 401938598
Notes: Four single guide RNAs and SpCas9 targeting sequences ATGAAGTGCCTAGCTTCATT, GAAGCTAGGCACTTCATCTA, ATTCATAATGGGACACTCGA, and CCCAGCCTCAGATTCATAAT flanking a chromosome 2 region distal to Npr3 were targeted in SS/JrHsdMcwi embryos. A 29,508 bp deletion in chromosome 2 (rn6: chr2:61,845,176-61,874,684) resulted, along with an insertion of 3 nucleotides (TGG). Please contact: [email protected]

Proper citation: RRID:RGD_401938598 Copy   


  • RRID:RGD_405855877

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=405855877

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 405855877
Notes: This is the wild type littermate from crossing of heterozygous mutant female rats with wild-type male rats to generate hemizygous null male rats and wild type mutant. Foxo4 mutant strain (RGD:405855876) was created in zygotes from Holtzman Sprague-Dawley. Guided RNAs targeting exon 2 (target sequence: CCAGATATACGAATGGATGGTCC; nucleotides 517-539) and exon 3 (target sequence: GTTCATCAAGGTACATAACGAGG; nucleotides 631-653) of the Foxo4 gene (NM_001106943.1)) were injected to the embryos to create a 3096-bp deletion including the 3' part of exon 2 and 5' part of exon 3, and resulting a premature stop of the protein.

Proper citation: RRID:RGD_405855877 Copy   


  • RRID:RGD_598092588

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092588

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-27)
Alternate IDs: 598092588
Notes: The T2A, nlsCre, and BGHpolyA are knocked in at the stop codon in the 13th exon of the tyrosine hydroxylase (TH) gene (NCBI Gene ID: 25085). National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_598092588 Copy   


  • RRID:RGD_598154597

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598154597

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-04-30)
Alternate IDs: 598154597
Notes: The CRISPR/Cas9 genome editing system targeting exon 2 of rat Mkx gene was injected to the Wistar embryo to generate this knock out rat strain with 7- bp deletion causing frameshift mutation in the gene. National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_598154597 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092586

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-27)
Alternate IDs: 598092586
Notes: The ES cell line derived from Lister Hooded rats (Seac:LIS), which was established by Prof. Sakimura at Department of Animal Model Development, Brain Research Institute, Niigata University, was used. Cloned ES cells established by introducing a vector of RCaMP2-flox stop at the Rosa26 locus were injected into fertilized eggs of SD rats (Slc:SD) using a microinjection method. RCaMP2 stands for red calcium indicator (PMID: 25419959). National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_598092586 Copy   


  • RRID:RGD_598154599

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598154599

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2025-04-30)
Alternate IDs: 598154599
Notes: This strain was generated at the Institute of Medical Science, University of Tokyo, by using CRISPR-Cas3. Microinjected into pronuclear-stage rat embryos of the F344/Jcl strain. The embryos were transferred into the oviducts of pseudopregnant females. A strain with a 1,869 bp deletion in the Il2rg gene was established from the resulting litters. National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_598154599 Copy   


  • RRID:RGD_598092510

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092510

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryopreserved Sperm (as of 2025-03-21)
Alternate IDs: 598092510
Notes: we used CRISPR-Cas9 technology to generate a PBK KO rat. Cas9 editing of exon 4 in the rat PBK gene resulted in the insertion of a single “T” resulting in a frame shift and premature termination of the PBK protein. PMCID: PMC11650665 Availability Contact Email: [email protected] at Augusta University

Proper citation: RRID:RGD_598092510 Copy   


  • RRID:RGD_408364982

    This resource has 1+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=408364982

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2024-11-08)
Alternate IDs: 408364982
Notes: The C1ql3 knout rats were established using CRISPR/cas9 method. The exon 1 of C1ql3 was targeted with two sgRNAs of (TCATC CTC ATC CCG GTG CTGG) and (AAGGT GCT GAC AAG AGG GAGG), which, respectively, targeted on the 5′ end and the 3′ end of exon 1.Wistar embryos born from Sprague Dawley pseudo-pregnant female were genotyped by polymerase chain reaction (PCR) with two upstream primers of (5′-TCCAAAAG CAG ACA AGA GGATC-3′ and 5′-CTACTTCT TCA CCT ACC ACG TCCTG-3′) and one downstream primer (5′-GGCTTCTG AAA CCT TAT ACA TTCTCG-3′). This mutant carried a 631-bp deletion resulting a premature stop at 61 bp of the open reading frame. National Human Disease Animal Model Resource Center, Beijing, China (https://namr.org.cn/Ldesc/1_1074)

Proper citation: RRID:RGD_408364982 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=616336066

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct (as of 2025-05-14)
Alternate IDs: 616336066
Notes: F344/Jcl rat fertilized eggs were microinjected and then transplanted into the oviducts of pseudopregnant females. From the resulting offspring, rats with the Alb promoter-Cre sequence inserted into the ROSA26 gene were selected and established. The Alb promoter-Cre sequence is inserted in an inverted position. Cre is expressed specifically in the liver. National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_616336066 Copy   


  • RRID:RGD_616336067

    This resource has 1+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=616336067

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-05-14)
Alternate IDs: 616336067
Notes: Fertilized eggs from F344/Jcl rats were microinjected and then transplanted into the oviducts of pseudopregnant females. From the resulting offspring, rats with the 2A-Cre sequence inserted into the Albumin gene were selected and established. National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_616336067 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=616336065

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-05-14)
Alternate IDs: 616336065
Notes: F344/Jcl rat fertilized eggs were microinjected and then transplanted into the oviducts of pseudopregnant females. From the resulting offspring, rats with the Alb promoter-Cre sequence inserted into the Rosa26 gene were selected and established. Although the Alb promoter is inserted, cre leakage is confirmed throughout the body. National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_616336065 Copy   


  • RRID:RGD_598092591

    This resource has 1+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092591

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-27)
Alternate IDs: 598092591
Notes: The T2A, nlsCre, and BGHpolyA are knocked in at the stop codon in the 13th exon of the tyrosine hydroxylase (TH) gene (NCBI Gene ID: 25085). National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_598092591 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=616336063

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 616336063
Notes: This rat strain with neuronal specific knock out of Mt-co3 was generated by crossing a rat neuron-specific Cre strain (NeuN-Cre) with SD-ROSA26 em1(CAG-loxP-stop-loxP-DdCBE-Mt-co3/Ilas. Compared with the controls, the neuron-specific Mt-co3 knock out rats were largely normal in the first postnatal month, but progressively developed ALS-like symptoms afterward. Rat Resource Center of China (www.ratresource.com)

Proper citation: RRID:RGD_616336063 Copy   


  • RRID:RGD_598092592

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092592

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-27)
Alternate IDs: 598092592
Notes: The T2A, nlsCre, and BGHpolyA are knocked in at the stop codon in the 13th exon of the tyrosine hydroxylase (TH) gene (NCBI Gene ID: 25085). National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_598092592 Copy   


  • RRID:RGD_598092593

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092593

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-28)
Alternate IDs: 598092593
Notes: Deletion of exon1 of Gpr143 gene in Wistar rats (Charles River, Japan) by CRISPR/Cas9. Line No. is 19. National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_598092593 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=616335894

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 616335894
Notes: The knock in of "CAG-loxP-stop-loxP-DdCBE-Mt-co3" to ROSA26 was induced by CRISPR/Cas9 in SD embryos from Vital River. This ROSA 26 knock in construct carrying DddA-derived cytosine base editor (DdCBE)linked to Mt-co3 was used to introduce premature stop codons in the rat Mt-co3 in mitochondrial genome in the presence of Cre recombinase. Rat Resource Center of China (www.ratresource.com)

Proper citation: RRID:RGD_616335894 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X