Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Species:caenorhabditis elegans (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

62,713 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
VC3103
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037672 Caenorhabditis elegans F38E9.5(gk3181) X. Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain is homozygous for a deletion (gk3181) in F38E9.5, detectable by PCR using the following primers. External left primer: GAGCAGCCAAAGGCTCATAC. External right primer: GGCTAGTCTCGGACTGGTTG. Internal left primer: GTGCTTCATTCTGTTCCGGT. Internal right primer: TTCCAATGATTCGAGGGTTC. Internal WT amplicon: 1591 bp. Deletion size: approximately 500 bp. Validation: gk3181 passed by CGH. Deleted probe: GAAGAAAGCATTTAGAAGTTATAGCTTTGGACTAGCATCCGTTTTAAAAT."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00018187(twf-2) WBGene00018187(twf-2) WB-STRAIN:WBStrain00037672 WormBase (WB) WB available WB-STRAIN:VC3103, CGC_VC3103 2026-08-15 09:33:31 0
VC3110
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037675 Caenorhabditis elegans ztf-22(gk3235) II. Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y48C3A.4. External left primer: CCATTTCTAACATAGGGGCTTTATT. External right primer: TATTTCGGCATTTTACCAAATTTTA. Internal left primer: TGTGAAAAAGAGCCAAATTGATAA. Internal right primer: GAGGTTTTTCCTGAAAATTGAAAA. Internal WT amplicon: 1190 bp. Deletion size: 369 bp. Deletion left flank: TTTGGAGCAACGTGTTTAAAGTGTTGAAGA. Deletion right flank: GGTTGGCAAGTGTTAAAATGTCCAAATATC. Validation: gk3235 passed by CGH." WBGene00012988(ztf-22) WBGene00012988(ztf-22) WB-STRAIN:WBStrain00037675 WormBase (WB) WB available WB-STRAIN:VC3110, CGC_VC3110 2026-08-15 09:33:31 0
VC3111
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037676 Caenorhabditis elegans gpb-2(ok3691)/szT1 [lon-2(e678)] I; +/szT1 X. F52A8.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3691 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AATAATCAAGCCCAAATGCG. External right primer: CCAACAACTTGGGTTATGGC. Internal left primer: TTCCATCAGGAGAAGTTCGG. Internal right primer: ATCGCTTGCGGGTAAGATTT. Internal WT amplicon: 1318 bp. Deletion size: 393 bp. Deletion left flank: TTGTCACTTCTTCTCGAGGAGTACACTAGC. Deletion right flank: ACATGTTGAATCTCCACTTCCAGTTAAAAT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00001680(gpb-2)|WBGene00003056(lon-2) WBGene00001680(gpb-2), WBGene00003056(lon-2) WB-STRAIN:WBStrain00037676 WormBase (WB) WB available WB-STRAIN:VC3111, CGC_VC3111 2026-08-15 09:33:31 0
VC3106
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037673 Caenorhabditis elegans cpn-3(ok3766) I. F28H1.2. External left primer: TTTTTAAGTCCGGCAAATGG. External right primer: ATGTTTTTGCTGTGAAGCCC. Internal left primer: AGGCGCACACTATTTTTCGT. Internal right primer: CCGGCGTATAGAAACCAGAG. Internal WT amplicon: 1306 bp. Deletion size: 543 bp. Deletion left flank: GATCAAGAAGCTCTCCGGTGAGAACATCTC. Deletion right flank: ACAAAGCTCGATTCTTCTCTCTTTTCTGCC.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00000779(cpn-3) WBGene00000779(cpn-3) WB-STRAIN:WBStrain00037673 WormBase (WB) WB available WB-STRAIN:VC3106, CGC_VC3106 2026-08-15 09:33:31 0
VC3108
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037674 Caenorhabditis elegans mel-46(ok3760) IV. Made_by: Vancouver KO Group|"T06A10.1. External left primer: CAGCTTGTCTCCCGAATCTC. External right primer: AGGCCAACAATAGCCAAAAA. Internal left primer: CTCGTCTTTCTCGCGTTTTC. Internal right primer: TTTGAGCAATTCTGGACTAAAAA. Internal WT amplicon: 1270 bp. Deletion size: 448 bp. Deletion left flank: GACGTGAAGGCTTCACGAATGTGTTGGAGC. Deletion right flank: ACAGAAAAATGGGCGGGGCACAGTTTTGCA. Insertion Sequence: AGAAAAAT."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00020284(mel-46) WBGene00020284(mel-46) WB-STRAIN:WBStrain00037674 WormBase (WB) WB available WB-STRAIN:VC3108, CGC_VC3108 2026-08-15 09:33:31 0
VC3112
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037677 Caenorhabditis elegans C41A3.1(ok3769) X. C41A3.1. External left primer: AAGCTTGGCGATCAGGTAGA. External right primer: CAGTTGACTCAATTTCCGCA. Internal left primer: ACGGCATAATACCGAACCAG. Internal right primer: TGCTCGTCAACAATGTTCGT. Internal WT amplicon: 1141 bp. Deletion size: 689 bp. Deletion left flank: CTCAATCCGACTCTGCGATGGAGGATATTT. Deletion right flank: GATCTGCCAGCTATTTGCTTGTGGGTTTGA.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00016558(pks-1) WBGene00016558(pks-1) WB-STRAIN:WBStrain00037677 WormBase (WB) WB available WB-STRAIN:VC3112, CGC_VC3112 2026-08-15 09:33:31 0
VC3121
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037683 Caenorhabditis elegans T07D10.1(gk3249) I; F59E12.3(gk3183) II; Y116A8C.5(gk3250) IV; unc-83(gk3251) gkDf35 V; gkDf32 X. Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain is homozygous for a deletion (gk3183) in F59E12.3, detectable by PCR using the following primers. External left primer: GCATGCAAGAAATGCAAGAA. External right primer: TGAAGTCGCGCACAAATAAG. Internal left primer: TCACAAATGGAAACGTGTGG. Internal right primer: CAACGAGGCCAAAGTGATTT. Internal WT amplicon: 1320 bp. Deletion size: 585 bp. Deletion left flank: GAACTGACAACAAGTATCTCAACCTACACG. Deletion right flank: CCCCCGTTTATGCGCCCAGGGCATCCCACA. Validation: gk3183 passed by CGH. Other deletions (gkDf32, gkDf35, gk3249, gk3250, gk3251) identified by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00006815(unc-83)|WBGene00011581(T07D10.1)|WBGene00013786(nep-24)|WBGene00019119(F59E12.3) WBGene00006815(unc-83), WBGene00011581(T07D10.1), WBGene00013786(nep-24), WBGene00019119(F59E12.3) WB-STRAIN:WBStrain00037683 WormBase (WB) WB available WB-STRAIN:VC3121, CGC_VC3121 2026-08-15 09:33:31 0
VC3118
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037681 Caenorhabditis elegans M05B5.2(ok3716)/szT1 [lon-2(e678)] I; +/szT1 X. M05B5.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3716 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGGCAGTTTCAGGGTTCAAA. External right primer: CTAAGGCACTTGGCTTTTGC. Internal left primer: GGGAGGAAATTTCAAAAATGA. Internal right primer: AAAAATTTAACGCGTCGCTG. Internal WT amplicon: 1169 bp. Deletion size: 569 bp. Deletion left flank: GGAATGGCAAATTGACAGCATGAGGGTTTC. Deletion right flank: TTTTTGGGATGTTCAGCGACGCGTTAAATT. Insertion Sequence: TTT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00003056(lon-2)|WBGene00010870(let-522) WBGene00003056(lon-2), WBGene00010870(let-522) WB-STRAIN:WBStrain00037681 WormBase (WB) WB available WB-STRAIN:VC3118, CGC_VC3118 2026-08-15 09:33:31 0
VC3054
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037648 Caenorhabditis elegans F52B11.2(ok3718) IV/nT1 [qIs51] (IV;V). F52B11.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3718 homozygotes (early- to mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTCCTGAAATATGGCGGAGA. External right primer: TCTTCTGGCCCTTCAACAGT. Internal left primer: ACACGAAGCACTGGCTTTTT. Internal right primer: GTCCGACAGTCCGTTCGT. Internal WT amplicon: 1267 bp. Deletion size: 518 bp. Deletion left flank: AATGTATTATTTTCCATTTTCCGAATTTTT. Deletion right flank: CGGATTCAAGGGCACCGAACCGTATCCAGT. Insertion Sequence: TT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00009925(F52B11.2) WBGene00009925(F52B11.2) WB-STRAIN:WBStrain00037648 WormBase (WB) WB available WB-STRAIN:VC3054, CGC_VC3054 2026-08-15 09:33:30 0
VC3042
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037642 Caenorhabditis elegans C06A12.3(ok3746) IV. C06A12.3. External left primer: CAATGCAACGCCAATTGTTA. External right primer: CTCATCAATGCCTTGCTCCT. Internal left primer: TCCATTGTTTGAAGAGTGCTG. Internal right primer: CGAATTGGCTAAAAACTCGAA. Internal WT amplicon: 1192 bp. Deletion size: 336 bp. Deletion left flank: TATGTTCCATTGTTTGAAGAGTGCTGTTCT. Deletion right flank: TGAATAGAAAACGTCACGAAGTGGTGAGTT.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00007357(C06A12.3) WBGene00007357(C06A12.3) WB-STRAIN:WBStrain00037642 WormBase (WB) WB available WB-STRAIN:VC3042, CGC_VC3042 2026-08-15 09:33:30 0
VC3041
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037641 Caenorhabditis elegans F48C1.4(ok3745) I. F48C1.4. External left primer: AACGATAGGAGACACGGTGG. External right primer: TGTGGTTGTTTTCGTTGCAT. Internal left primer: CAAGTTGAGAGTCCGCAGTG. Internal right primer: ACCATAAACTTGTTCGCGCT. Internal WT amplicon: 1143 bp. Deletion size: 523 bp. Deletion left flank: TTAGACAACTAACCATAGAGCGTGCAAATC. Deletion right flank: TGTTTCAGTGTTCTCCTTCCTGAAAAAAAA.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WB-STRAIN:WBStrain00037641 WormBase (WB) WB available WB-STRAIN:VC3041, CGC_VC3041 2026-08-15 09:33:30 0
VC3046
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037646 Caenorhabditis elegans aly-1(ok3754) IV. C01F6.5. External left primer: CAACTCCCCCAAATTGGTAA. External right primer: GACGAAGGGATGATATGGGA. Internal left primer: TTTTTGATGTCACCTACCTATTCTA. Internal right primer: TTTGTTCGCCGTTCAATATG. Internal WT amplicon: 1251 bp. Deletion size: 617 bp. Deletion left flank: TCTCCAGATACTCCATCCACCTAGTCTATC. Deletion right flank: CGTGAACTTCAACGAGCACGGAAAACCAGT.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00000120(aly-1) WBGene00000120(aly-1) WB-STRAIN:WBStrain00037646 WormBase (WB) WB available WB-STRAIN:VC3046, CGC_VC3046 2026-08-15 09:33:30 0
VC3049
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037647 Caenorhabditis elegans hel-1(ok3698)/mT1 II; +/mT1 [dpy-10(e128)] III. C26D10.2. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3698 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CAACCAAGTTCTGGCCATCT. External right primer: TTCCATTCTCCTTCCACCTG. Internal left primer: GGCGGAGAACATCATCACTT. Internal right primer: TTTCGGATCGTTTCGCTACT. Internal WT amplicon: 1141 bp. Deletion size: 721 bp. Deletion left flank: TGTCGCACTCGTCCAGGACGAAGTACTTGA. Deletion right flank: GAAATTTAGTAAATAACCTCACAAAAACAG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00001072(dpy-10)|WBGene00001840(hel-1) WBGene00001072(dpy-10), WBGene00001840(hel-1) WB-STRAIN:WBStrain00037647 WormBase (WB) WB available WB-STRAIN:VC3049, CGC_VC3049 2026-08-15 09:33:30 0
VC3075
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037659 Caenorhabditis elegans tsp-3(ok3729) III. Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y39E4B.4. External left primer: AAACCGCATTTGTCCGAATA. External right primer: TGCCCCCACTAACCAATATC. Internal left primer: TGTCTTAAAGCAAACGTGCAA. Internal right primer: ACTACTGCCGGCTCTATCGG. Internal WT amplicon: 1181 bp. Deletion size: 351 bp. Deletion left flank: GTTTTGATAAAGGCTTCGAATCGGAAATTC. Deletion right flank: AGGCTCCATACTTTCTGTTTATGGTTATCT." WBGene00006629(tsp-3) WBGene00006629(tsp-3) WB-STRAIN:WBStrain00037659 WormBase (WB) WB available WB-STRAIN:VC3075, CGC_VC3075 2026-08-15 09:33:30 0
VC3062
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037654 Caenorhabditis elegans F25H8.2(ok3636) IV/nT1 [qIs51] (IV;V). F25H8.2. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3636 homozygotes (sterile). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATGCAAACATGCTCCAATGA. External right primer: ATTATCCGATCTGGCAGGTG. Internal left primer: AACAAACGACACTCCGATTTC. Internal right primer: ATCTCGTTTTCGCCCTCTGT. Internal WT amplicon: 1333 bp. Deletion size: 333 bp. Deletion left flank: GAATGATTAGATTTCTAGCGTAATGTTCAC. Deletion right flank: AGAAGTTTTATAGGCATCGATGATACCCAT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00009132(F25H8.2) WBGene00009132(F25H8.2) WB-STRAIN:WBStrain00037654 WormBase (WB) WB available WB-STRAIN:VC3062, CGC_VC3062 2026-08-15 09:33:30 0
VC3059
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037651 Caenorhabditis elegans irg-8(ok3738) V. Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK6.11. External left primer: ATCAGTCATAAGGCGATGGG. External right primer: CCATTTCAATAAACCGGTCG. Internal left primer: AAGGCTTCAAGGCTGTCAGA. Internal right primer: GTGGCTCGGTTTCACACTTT. Internal WT amplicon: 1209 bp. Deletion size: 496 bp. Deletion left flank: CAGCGTACAGATATGCCAGAGCAGTAGAGT. Deletion right flank: TAAATATTATACGGCGGGTAAACTTTAAAA." WBGene00022645(irg-8) WBGene00022645(irg-8) WB-STRAIN:WBStrain00037651 WormBase (WB) WB available PMID:32009302
PMID:32560629
WB-STRAIN:VC3059, CGC_VC3059 2026-08-15 09:33:30 0
VC3060
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037652 Caenorhabditis elegans +/szT1 [lon-2(e678)] I; C33A11.1(ok3681)/szT1 X. C33A11.1. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3681 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCTGGTTGTCCTTTGCTGTT. External right primer: CTGTTACGCTGTGCTGGAAA. Internal left primer: ACATGGGTTTGTCCCTTTTT. Internal right primer: CCCCCATAATTTTCATATCACG. Internal WT amplicon: 1298 bp. Deletion size: 1022 bp. Deletion left flank: TCATTTTTATTTGAATCATCAACTTTTAAA. Deletion right flank: AGCTCAAGATGAAAAAAGAAAAAGAGCAGG. Insertion Sequence: ATATTTTGACTTCCTTTTTTATTTTTTTTTTCT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00003056(lon-2)|WBGene00007877(nfki-1) WBGene00003056(lon-2), WBGene00007877(nfki-1) WB-STRAIN:WBStrain00037652 WormBase (WB) WB available WB-STRAIN:VC3060, CGC_VC3060 2026-08-15 09:33:30 0
VC3072
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037657 Caenorhabditis elegans scd-2(ok3702) V. Reference WBPaper00058832 added based on published strain data identified by Textpresso literature search.|"T10H9.2. External left primer: ATCACAAACCAATTGGGGAA. External right primer: TAATCCGGCTGGAAGAAATG. Internal left primer: CCCTGCGTATGCTAATTGGT. Internal right primer: TCCGGTCTAGTGGTAATCCG. Internal WT amplicon: 1147 bp. Deletion size: 660 bp. Deletion left flank: CTGATTTTATCGTTGAACGACGCGATAATC. Deletion right flank: CTTGTACAACATTACGTTTTTGATCTTCGC."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00004740(scd-2) WBGene00004740(scd-2) WB-STRAIN:WBStrain00037657 WormBase (WB) WB available PMID:31704915 WB-STRAIN:VC3072, CGC_VC3072 2026-08-15 09:33:30 0
VC3074
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037658 Caenorhabditis elegans cdk-2(ok3728) I. K03E5.3. External left primer: AAAATGCGTATTTCGCAACC. External right primer: AATTTCGTTCGATGACACCC. Internal left primer: CTTGTGTCGATTTACGGGCT. Internal right primer: TGAAGAGGAAAGACTCGGTAAAA. Internal WT amplicon: 1155 bp. Deletion size: 246 bp. Deletion left flank: GAATTAAAATAATTTATTAATTTAAATAAC. Deletion right flank: TTCCAAAAAAAAACATAAATTTCGATTATT. Insertion Sequence: CAAAAAAAAACATAAA.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00019362(cdk-2) WBGene00019362(cdk-2) WB-STRAIN:WBStrain00037658 WormBase (WB) WB available WB-STRAIN:VC3074, CGC_VC3074 2026-08-15 09:33:30 0
VC3078
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037661 Caenorhabditis elegans F10E9.1(ok3764) III. F10E9.1. External left primer: AGCTGAAAAATGCTGTCGGT. External right primer: TTAAATGTGCAATGGTCCGA. Internal left primer: TACTGCACCACCGTTCAAAA. Internal right primer: CAGCTTCCTCATTTTCTGTTCTT. Internal WT amplicon: 1235 bp. Deletion size: 625 bp. Deletion left flank: AGTTGCTGGACAAAACAGCCGTGAGGAAGC. Deletion right flank: GGATACTTGAAATAAAAGGGAGCAGGAATC. Insertion Sequence: TTGAAATAAAA.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00017353(F10E9.1) WBGene00017353(F10E9.1) WB-STRAIN:WBStrain00037661 WormBase (WB) WB available WB-STRAIN:VC3078, CGC_VC3078 2026-08-15 09:33:30 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.