Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
col-43::mNG(syb7608) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062958 | Caenorhabditis elegans | col-43::mNG(syb7608) V. | Made_by: SunyBiotech|"mNG inserted at C-terminus of endogenous col-43 locus." | WBGene00000620(col-43) | WBGene00000620(col-43) | WB-STRAIN:WBStrain00062958 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:48 | 0 | ||||
|
col-91::mNG(syb7670) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062959 | Caenorhabditis elegans | col-91::mNG(syb7670) III. | Made_by: SunyBiotech|"mNG inserted at C-terminus of endogenous col-91 locus." | WBGene00000666(col-91) | WBGene00000666(col-91) | WB-STRAIN:WBStrain00062959 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:48 | 0 | ||||
|
grl-2(syb7064[sfGFP::grl-2]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062951 | Caenorhabditis elegans | grl-2(syb7064[sfGFP::grl-2]) V. | Made_by: SUNY Biotech|"sfGFP tag inserted into endogenous grl-2 locus using CRISPR/Cas9. Tag inserted immediately following the signal peptide. Reference: Serra ND, et al. 2024 Development. Aug 7;227(4):iyae081. doi: 10.1093/genetics/iyae081. PMID: 38739761." | WBGene00001711(grl-2) | WBGene00001711(grl-2) | WB-STRAIN:WBStrain00062951 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:48 | 0 | ||||
|
ZK993.5(ve902[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063004 | Caenorhabditis elegans | ZK993.5(ve902[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. | Homozygous viable. Deletion of 3478 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAAGTGATAACGGGTGTGTTGCAATACCA ; Right flanking sequence: TATTTTAATCAGTTATGATAACTTTATGAT. ZK993.5 sgRNA A: CCAAGTAAGAATTATAGTGG; ZK993.5 sgRNA B: TATTAGCATATCCAACAGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063004 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:48 | 0 | ||||
|
col-174::mNG(syb7565) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062954 | Caenorhabditis elegans | col-174::mNG(syb7565) X. | Made_by: SunyBiotech|"mNG inserted at C-terminus of endogenous col-174 locus." | WBGene00000747(col-174) | WBGene00000747(col-174) | WB-STRAIN:WBStrain00062954 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:48 | 0 | ||||
|
col-128::mNG(syb7567) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062955 | Caenorhabditis elegans | col-128::mNG(syb7567) IV. | Made_by: SunyBiotech|"mNG inserted at C-terminus of endogenous col-128 locus." | WBGene00000702(col-128) | WBGene00000702(col-128) | WB-STRAIN:WBStrain00062955 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:48 | 0 | ||||
|
vha-13(syb731[wrmScarlet::vha-13]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062952 | Caenorhabditis elegans | vha-13(syb731[wrmScarlet::vha-13]) V. | Made_by: SunyBiotech|"wrmScarlet inserted at N-terminus of endogenous vha-13 locus. wrmScarlet expression in the intestine and other tissues. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628." | WBGene00013025(vha-13) | WBGene00013025(vha-13) | WB-STRAIN:WBStrain00062952 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:48 | 0 | ||||
|
F56A6.5(ve905[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063007 | Caenorhabditis elegans | F56A6.5(ve905[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. | Homozygous viable. Deletion of 1286 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCACAAGCACATTTAATTTTTCAAACCCCC ; Right flanking sequence: GCATTCAGTAACCTTCATCGCAAAAATAGT. F56A6.5 sgRNA A: GATTTCTTCATGACTCCTGA; F56A6.5 sgRNA B: AGTATATGCTATGATGAATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063007 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:48 | 0 | ||||
|
ceh-44(syb7529[ceh-44(exon 4)::GFP]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062953 | Caenorhabditis elegans | ceh-44(syb7529[ceh-44(exon 4)::GFP]) III. | GFP tag inserted in exon 4 of endogenous ceh-44 locus. Broad, weak, punctate GFP expression in non-neuronal cells. Please contact Oliver Hobert prior to publishing work using this strain.|"Made_by: SUNY Biotech" | WBGene00000464(ceh-44) | WBGene00000464(ceh-44) | WB-STRAIN:WBStrain00062953 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:48 | 0 | ||||
|
tbx-32(ve906[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063008 | Caenorhabditis elegans | tbx-32(ve906[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | Homozygous viable. Deletion of 1714 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATTGAAAAAGGAAAGAGGGGTGTGGTCAAT ; Right flanking sequence: GGATGACAACGCTATCTTTGAGCATTTTTT. tbx-32 sgRNA A: ATGGAGCATTATCAAGAAGG; tbx-32 sgRNA B: TCCACGTTTTCTTCAAGAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006551(tbx-32)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006551(tbx-32), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063008 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:48 | 0 | ||||
|
rps-29(ve992[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC1(s2023) [dpy-1(s2170) umnIs41] III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063081 | Caenorhabditis elegans | rps-29(ve992[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC1(s2023) [dpy-1(s2170) umnIs41] III. | Made_by: RG KO Group|"umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Larval arrest. Deletion of 754 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve992 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: caccgtcttcttgttttccgcttttttcct; Right flanking sequence: gttaacttcatgtcttcaatcaataaattg. rps-29 crRNA A: ttcgaaaaagctgtaaacgg; rps-29 crRNA B: aataacaagatttgacgagg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00001063(dpy-1)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00004498(rps-29)|WBGene00006789(unc-54) | WBGene00001063(dpy-1), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00004498(rps-29), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063081 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:49 | 0 | ||||
|
K02D10.4(ve995[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063082 | Caenorhabditis elegans | K02D10.4(ve995[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. | Homozygous viable. Deletion of 1717 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgcgctccattggcaaatgaaaacgctccg ; Right flanking sequence: TGGAATTATAAGCAATTTTTCAAAAATCTA. K02D10.4 sgRNA A: cgagaccgaactgttgaggg; K02D10.4 sgRNA B: ATGATGAACACGATGACATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063082 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:49 | 0 | ||||
|
egrh-3(ve983[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063074 | Caenorhabditis elegans | egrh-3(ve983[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | Homozygous viable. Deletion of 8336 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAAGCTTGTGATGCTCCACCACCAGCTCCA ; Right flanking sequence: tggcctagaaaaaagttaggccaccaataa. egrh-3 crRNA A: ACGACATTTAAGCTTCAGGG; egrh-3 crRNA B: CACGCGattttctgatacgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00044651(egrh-3) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00044651(egrh-3) | WB-STRAIN:WBStrain00063074 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:49 | 0 | ||||
|
+/mT1 [umnIs52] II; eftu-2(ve984[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063075 | Caenorhabditis elegans | +/mT1 [umnIs52] II; eftu-2(ve984[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. | Made_by: RG KO Group|"umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Larval arrest. Deletion of 2360 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve984 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Note: some, but not all balanced heterozygotes display vulva phenotypes such as blips, explode at vulva, and/or egl. Left flanking Sequence: TGTTCTTCATGAAGATAAAAAGTACTATGC; Right flanking sequence: TGGAGGTCAGATGATCCCAACTGCACGCCG. eftu-2 sgRNA #1: TACAGCTCTCGAAGTATACG; eftu-2 sgRNA #2: ACAGAACCACTTTATCGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00001072(dpy-10)|WBGene00001166(eftu-2)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00001072(dpy-10), WBGene00001166(eftu-2), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063075 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:49 | 0 | ||||
|
col-123(ve980[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063072 | Caenorhabditis elegans | col-123(ve980[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | Homozygous viable. Deletion of 1079 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. The indel of col-123 resides within an intron of catp-6. It is not known if ve980 affects catp-6 expression or function. Left flanking Sequence: ggaaatgatgggaatattttcagagttcct ; Right flanking sequence: AGGTGGAGGCGGCGGAGGCGGAGAATACAA. col-123 sgRNA A: ATGACACTTGCATtctatac; col-123 sgRNA B: TCTCATGGTGGTTCATCTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00000697(col-123)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00000697(col-123), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063072 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:49 | 0 | ||||
|
myo-2(ftw64[myo-2(head)::SL2::GFP::myo-2(tail)]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063111 | Caenorhabditis elegans | myo-2(ftw64[myo-2(head)::SL2::GFP::myo-2(tail)]) X. | Severing and tagging of the endogenous locus with trans-splicing SL2 and GFP using CRISPR/Cas9. GFP expression in pharynx muscle. Impared pumping behavior, grows slowly. Please contact Ryan Littlefield prior to publishing work using this strain. | WBGene00003514(myo-2) | WBGene00003514(myo-2) | WB-STRAIN:WBStrain00063111 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:50 | 0 | ||||
|
rps-17(ve989[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063079 | Caenorhabditis elegans | rps-17(ve989[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. | Made_by: RG KO Group|"umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Sterile. Deletion of 459 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ heterozygotes, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 ve989 homozygotes (most are inviable, some reach adulthood and are sickly, sterile with a protruding vulva, some may produce a small brood), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: acttacAGCGGCCTTGAGCATGTCGCTGGT; Right flanking sequence: aggtcgaatgagaaaaaaattaattgatat. rps-17 crRNA A: ATCAGTGTCAACCTTGATGG; rps-17 crRNA B: gcgcaacgtaatagatgaac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00003514(myo-2)|WBGene00004486(rps-17)|WBGene00004496(rps-27)|WBGene00006778(unc-42)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004486(rps-17), WBGene00004496(rps-27), WBGene00006778(unc-42), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063079 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:49 | 0 | ||||
|
rps-15A(ve986[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC1(s2023) [dpy-1(s2170)umnIs41] III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063076 | Caenorhabditis elegans | rps-15A(ve986[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC1(s2023) [dpy-1(s2170)umnIs41] III. | Made_by: RG KO Group|"umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Early larval arrest. Deletion of 598 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve986 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Other names: CELE_F53A3.3, uS8, rps-22. Left flanking Sequence: ATGAACGTCCTCGCCGATGCGCTCAACGCC; Right flanking sequence: CACGAGGAGGCCAGAAGAAAGCATTTGGGA. rps-22 crRNA A: ATCAACAACGCCGAGAAGCG; rps-22 crRNA B: ATCCATGATTCCGGCGGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00001063(dpy-1)|WBGene00003514(myo-2)|WBGene00004484(rps-15)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00001063(dpy-1), WBGene00003514(myo-2), WBGene00004484(rps-15), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063076 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:49 | 0 | ||||
|
dhs-20(ve987[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063077 | Caenorhabditis elegans | dhs-20(ve987[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. | Homozygous viable. Deletion of 1097 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTTTGGGATATTATTTTTAAAAAACCCT ; Right flanking sequence: ATTGATAAGGTTTTTTTGTTCTTGATTCTT. dhs-20 sgRNA A: GAGATTGTTAAAGGGTGTCC ; dhs-20 sgRNA B: TGGGTCGACCTTGAACACGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00000983(dhs-20)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00000983(dhs-20), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063077 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:49 | 0 | ||||
|
ftwEx1. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063110 | Caenorhabditis elegans | ftwEx1. | ftwEx1 [mlc-2p::GFP::SL2::mCherry::mlc-2]. Pick GFP+ to maintain. Extrachromosomal array expressing GFP and mCherry in muscles. Pharynx and bodywall muscles are visibly bright green by dissection fluorescence microscopy. WT movement and behavior. Please contact Ryan Littlefield prior to publishing work using this strain.|"Made_by: Ryan Littlefield & BLY321" | WB-STRAIN:WBStrain00063110 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:50 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
