Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Norway

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search
Reset search
On page 251 showing 5001 ~ 5020 out of 64,152 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

http://www.wormbase.org/db/get?name=WBStrain00052640

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:34555015
Synonyms: puf-8(q725)/mC6g II; unc-32(e189) glp-1(ar202)/hT2 III
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00052640 Copy   

http://www.wormbase.org/db/get?name=WBStrain00052645

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:34555015
Synonyms: cup-2(tm2838) I; puf-8(q725)/mC6g II; glp-1(oz264) III
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00052645 Copy   

http://www.wormbase.org/db/get?name=WBStrain00052641

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:34555015
Synonyms: puf-8(q725)/mC6g II; glp-1(oz264) III
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00052641 Copy   

http://www.wormbase.org/db/get?name=WBStrain00052642

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:34555015
Synonyms: rfp-1(ok572) glp-1(oz264)/hT2g III
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00052642 Copy   

http://www.wormbase.org/db/get?name=WBStrain00052649

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:34555015
Synonyms: der-2(tm6098) glp-1(ar202) III
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00052649 Copy   

    • RRID:WB-STRAIN:WBStrain00052744

http://www.wormbase.org/db/get?name=WBStrain00052744

Source Database: WormBase (WB)
Availability: unknown
Synonyms: EMPTY
Notes: [2023-02-08T18:27:49.812Z WBPerson712] New Strain: lin-32(tm2044)

Proper citation: RRID:WB-STRAIN:WBStrain00052744 Copy   

    • RRID:WB-STRAIN:WBStrain00052745

http://www.wormbase.org/db/get?name=WBStrain00052745

Source Database: WormBase (WB)
Availability: unknown
Synonyms: EMPTY
Notes: [2023-02-08T18:28:49.432Z WBPerson712] New Strain: lin-32(tm2044); tmEx3153[Plin-32::LIN-32;Pnmr-1::mCherry;pBluescripts KS+T1]

Proper citation: RRID:WB-STRAIN:WBStrain00052745 Copy   

    • RRID:WB-STRAIN:WBStrain00052746

http://www.wormbase.org/db/get?name=WBStrain00052746

Source Database: WormBase (WB)
Availability: unknown
Synonyms: EMPTY
Notes: [2023-02-08T18:30:57.828Z WBPerson712] New Strain: tmEx3090[Plin-32(4.2 kbp)::EGFP + Pnmr-1::mCherry]

Proper citation: RRID:WB-STRAIN:WBStrain00052746 Copy   

    • RRID:WB-STRAIN:WBStrain00052747

http://www.wormbase.org/db/get?name=WBStrain00052747

Source Database: WormBase (WB)
Affected Genes: WBGene00002177(jkk-1)
Genomic Alteration: WBGene00002177(jkk-1)
Availability: available
Source References: PMID:37038480
Synonyms: jkk-1(syb3225) X.
Alternate IDs: CGC_PHX3225
Notes: Made_by: Bringmann lab|"Putative jkk-1 gain-of-function allele. Reference: Busack I & Bringmann H. (2023). JKK-1(3E), a JKK-1 mutant with predicted phosphomimetic amino acid substitutions. microPublication Biology. 10.17912/micropub.biology.000785."|"[2023-03-20T22:37:06.807Z WBPerson712] New Strain: WBPaper00065130. PHX3225: jkk-1(syb3225) the phosphomimetic kinase mutant JKK-1(3E), we edited jkk-1 to introduce three amino acid substitutions, S274E, S278E and S280E."

Proper citation: RRID:WB-STRAIN:WBStrain00052747 Copy   

    • RRID:WB-STRAIN:WBStrain00052743

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00052743

Source Database: WormBase (WB)
Availability: available
Source References: PMID:35636511
Synonyms: risIs33; gpIs1.
Alternate IDs: CGC_MIR276
Notes: Made_by: Anita Goyala|"risIs33 [K03A1.5p::3xFLAG::SV40-NLS::dCas9::SV40-NLS::VP64::HA + unc-119(+)]. gpIs1 [hsp-16.2p::GFP]. Inducible GFP fluorescence after >1 hour heat shock at 35C. risIs33 transgene stably expresses a 171 kDa dCas9::VP64 fusion protein suitable for for CRISPR activation (CRISPRa) in C. elegans, as described in Fischer F, et al. J Biol Chem. 2022 May 27;102085. doi: 10.1016/j.jbc.2022.102085. PMID: 35636511. Derived by crossing parental strains MIR249 and TJ375."|"[2023-02-01T19:52:34.889Z WBPerson712] New Strain: MIR276, risIs33 [K03A1.5p::3xFLAG::SV40-NLS::dCas9::SV40-NLS::VP64::HA + unc-119(+)]; gpIs1 [hsp-16.2p::GFP] WBPaper00064116 identifier : pmid35636511"

Proper citation: RRID:WB-STRAIN:WBStrain00052743 Copy   

    • RRID:WB-STRAIN:WBStrain00052748

http://www.wormbase.org/db/get?name=WBStrain00052748

Source Database: WormBase (WB)
Availability: unknown
Synonyms: EMPTY
Notes: [2023-03-21T20:54:22.944Z WBPerson712] New Strain: WBPAPER00065094 tat-5(syb2519[E246Q]) / tmC18[dpy-5(tmIs1200[myo-2p::Venus])] I tat-5 syb2414[D244T] CAATTGACCGGTGAAACTGAT Created by SunyBiotech using CRISPR-Cas9-mediated genome editing (Paix et al. 2014) and verified by sequencing.

Proper citation: RRID:WB-STRAIN:WBStrain00052748 Copy   

    • RRID:WB-STRAIN:WBStrain00052749

http://www.wormbase.org/db/get?name=WBStrain00052749

Source Database: WormBase (WB)
Availability: unknown
Synonyms: EMPTY
Notes: [2023-03-21T20:55:14.342Z WBPerson712] New Strain: WBPAPER00065094 PHX2596 tat-5(syb2414[D244T]) / tmC18[dpy-5(tmIs1200[myo-2p::Venus])] I tat-5 syb2414[D244T] CAATTGACCGGTGAAACTGAT Created by SunyBiotech using CRISPR-Cas9-mediated genome editing (Paix et al. 2014) and verified by sequencing.

Proper citation: RRID:WB-STRAIN:WBStrain00052749 Copy   

    • RRID:WB-STRAIN:WBStrain00052792

http://www.wormbase.org/db/get?name=WBStrain00052792

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37273577
Synonyms: EMPTY
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00052792 Copy   

    • RRID:WB-STRAIN:WBStrain00052793

http://www.wormbase.org/db/get?name=WBStrain00052793

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37273577
Synonyms: EMPTY
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00052793 Copy   

    • RRID:WB-STRAIN:WBStrain00052794

http://www.wormbase.org/db/get?name=WBStrain00052794

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37273577
Synonyms: EMPTY
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00052794 Copy   

    • RRID:WB-STRAIN:WBStrain00052790

http://www.wormbase.org/db/get?name=WBStrain00052790

Source Database: WormBase (WB)
Availability: unknown
Synonyms: EMPTY
Notes: [2023-04-26T17:59:29.128Z WBPerson51134] New Strain: Information submitted by WBPerson466 on 2023-02-9_01:52:11 via the Allele submission form. Genotype rips-1(ka14) V

Proper citation: RRID:WB-STRAIN:WBStrain00052790 Copy   

    • RRID:WB-STRAIN:WBStrain00052799

http://www.wormbase.org/db/get?name=WBStrain00052799

Source Database: WormBase (WB)
Availability: unknown
Synonyms: EMPTY
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00052799 Copy   

    • RRID:WB-STRAIN:WBStrain00052832

http://www.wormbase.org/db/get?name=WBStrain00052832

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37396790
Synonyms: EMPTY
Notes: [2023-06-15T19:14:44.185Z WBPerson12028] New Strain: GLW55: utxIs2 [Phis-72::wrmScarlet1-10::tbb-2(3'UTR)] II WBPaper00065567

Proper citation: RRID:WB-STRAIN:WBStrain00052832 Copy   

    • RRID:WB-STRAIN:WBStrain00052833

http://www.wormbase.org/db/get?name=WBStrain00052833

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37396790
Synonyms: EMPTY
Notes: [2023-06-15T19:20:36.62Z WBPerson12028] New Strain: utxIs3 [Prab-3::wrmScarlet1-10::SEC::tbb-2 (3'UTR)] II; WBPaper00065567

Proper citation: RRID:WB-STRAIN:WBStrain00052833 Copy   

    • RRID:WB-STRAIN:WBStrain00052834

http://www.wormbase.org/db/get?name=WBStrain00052834

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37396790
Synonyms: EMPTY
Notes: [2023-06-15T19:21:07.139Z WBPerson12028] New Strain: utxIs4 [Prab-3::wrmScarlet1-10::tbb-2 (3'UTR)] II; his-72 (utx21 [his-72::wrmScarlet11::3xMyc]) III WBPaper00065567

Proper citation: RRID:WB-STRAIN:WBStrain00052834 Copy   

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

dkNET Webinar: A Hormone Cell Atlas Maps the Human Endocrine System at Cellular Resolution

dkNET community events and announcements in October, 2026

Test 10092026

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch