Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
VC3093 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037669 | Caenorhabditis elegans | glb-14(ok3757) V. | F21A3.6. External left primer: CAAATTGGCGAACTTCATCC. External right primer: AAATCCGTGATTTTTCGCAC. Internal left primer: CAAGCCTGTTTATAGACTTTTGGG. Internal right primer: AATTCCACTTTCCGAGCAGA. Internal WT amplicon: 1231 bp. Deletion size: 542 bp. Deletion left flank: ATACTGATGAATAATGCGTATCTAATAACT. Deletion right flank: CTGCAAGGCACGGCAGGCATTTTTGCGCCT. Insertion Sequence: GCAAGG.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00008996(glb-14) | WBGene00008996(glb-14) | WB-STRAIN:WBStrain00037669 | WormBase (WB) | WB | available | WB-STRAIN:VC3093, CGC_VC3093 | 2026-08-15 09:33:31 | 0 | |||
|
VC3086 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037666 | Caenorhabditis elegans | yop-1(ok3629) I. | This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y71F9B.3. External left primer: AGCCCTGACTGGTTCACATC. External right primer: AAAAAGGGAATTTTGGTGGG. Internal left primer: GCAAAAGGTCTTGGACGATG. Internal right primer: TCATTCCATGTGATCTCGGA. Internal WT amplicon: 1215 bp. Deletion size: 860 bp. Deletion left flank: AGCGGCTTCATTTGGTGCTCGGCGTCGTCG. Deletion right flank: TTCTCCGTTCAAATCGTCGCCGTTTTCCCA." | WBGene00022127(yop-1) | WBGene00022127(yop-1) | WB-STRAIN:WBStrain00037666 | WormBase (WB) | WB | available | WB-STRAIN:VC3086, CGC_VC3086 | 2026-08-15 09:33:31 | 0 | |||
|
VC3090 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037667 | Caenorhabditis elegans | mop-25.1(ok3762) X. | Made_by: Vancouver KO Group|"R02E12.2. External left primer: TTTTGGGCGTTTTTCTTACG. External right primer: ACAGAAGCTGTTGCCGAGTT. Internal left primer: GGAAATTTTGAACGACCACAG. Internal right primer: GAGTTGTTTTACAGGAATTCTCCA. Internal WT amplicon: 1136 bp. Deletion size: 392 bp. Deletion left flank: TTTCAAATATTCCATGACCACCCAAAAAAA. Deletion right flank: CATCCGCACAAGCTGTCTTCATCGTACTGT. Insertion Sequence: ATCTCGCATA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00019827(mop-25.1) | WBGene00019827(mop-25.1) | WB-STRAIN:WBStrain00037667 | WormBase (WB) | WB | available | WB-STRAIN:VC3090, CGC_VC3090 | 2026-08-15 09:33:31 | 0 | |||
|
VC3103 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037672 | Caenorhabditis elegans | F38E9.5(gk3181) X. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain is homozygous for a deletion (gk3181) in F38E9.5, detectable by PCR using the following primers. External left primer: GAGCAGCCAAAGGCTCATAC. External right primer: GGCTAGTCTCGGACTGGTTG. Internal left primer: GTGCTTCATTCTGTTCCGGT. Internal right primer: TTCCAATGATTCGAGGGTTC. Internal WT amplicon: 1591 bp. Deletion size: approximately 500 bp. Validation: gk3181 passed by CGH. Deleted probe: GAAGAAAGCATTTAGAAGTTATAGCTTTGGACTAGCATCCGTTTTAAAAT."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00018187(twf-2) | WBGene00018187(twf-2) | WB-STRAIN:WBStrain00037672 | WormBase (WB) | WB | available | WB-STRAIN:VC3103, CGC_VC3103 | 2026-08-15 09:33:31 | 0 | |||
|
VC3110 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037675 | Caenorhabditis elegans | ztf-22(gk3235) II. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y48C3A.4. External left primer: CCATTTCTAACATAGGGGCTTTATT. External right primer: TATTTCGGCATTTTACCAAATTTTA. Internal left primer: TGTGAAAAAGAGCCAAATTGATAA. Internal right primer: GAGGTTTTTCCTGAAAATTGAAAA. Internal WT amplicon: 1190 bp. Deletion size: 369 bp. Deletion left flank: TTTGGAGCAACGTGTTTAAAGTGTTGAAGA. Deletion right flank: GGTTGGCAAGTGTTAAAATGTCCAAATATC. Validation: gk3235 passed by CGH." | WBGene00012988(ztf-22) | WBGene00012988(ztf-22) | WB-STRAIN:WBStrain00037675 | WormBase (WB) | WB | available | WB-STRAIN:VC3110, CGC_VC3110 | 2026-08-15 09:33:31 | 0 | |||
|
VC3111 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037676 | Caenorhabditis elegans | gpb-2(ok3691)/szT1 [lon-2(e678)] I; +/szT1 X. | F52A8.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3691 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AATAATCAAGCCCAAATGCG. External right primer: CCAACAACTTGGGTTATGGC. Internal left primer: TTCCATCAGGAGAAGTTCGG. Internal right primer: ATCGCTTGCGGGTAAGATTT. Internal WT amplicon: 1318 bp. Deletion size: 393 bp. Deletion left flank: TTGTCACTTCTTCTCGAGGAGTACACTAGC. Deletion right flank: ACATGTTGAATCTCCACTTCCAGTTAAAAT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001680(gpb-2)|WBGene00003056(lon-2) | WBGene00001680(gpb-2), WBGene00003056(lon-2) | WB-STRAIN:WBStrain00037676 | WormBase (WB) | WB | available | WB-STRAIN:VC3111, CGC_VC3111 | 2026-08-15 09:33:31 | 0 | |||
|
VC3106 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037673 | Caenorhabditis elegans | cpn-3(ok3766) I. | F28H1.2. External left primer: TTTTTAAGTCCGGCAAATGG. External right primer: ATGTTTTTGCTGTGAAGCCC. Internal left primer: AGGCGCACACTATTTTTCGT. Internal right primer: CCGGCGTATAGAAACCAGAG. Internal WT amplicon: 1306 bp. Deletion size: 543 bp. Deletion left flank: GATCAAGAAGCTCTCCGGTGAGAACATCTC. Deletion right flank: ACAAAGCTCGATTCTTCTCTCTTTTCTGCC.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000779(cpn-3) | WBGene00000779(cpn-3) | WB-STRAIN:WBStrain00037673 | WormBase (WB) | WB | available | WB-STRAIN:VC3106, CGC_VC3106 | 2026-08-15 09:33:31 | 0 | |||
|
VC3108 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037674 | Caenorhabditis elegans | mel-46(ok3760) IV. | Made_by: Vancouver KO Group|"T06A10.1. External left primer: CAGCTTGTCTCCCGAATCTC. External right primer: AGGCCAACAATAGCCAAAAA. Internal left primer: CTCGTCTTTCTCGCGTTTTC. Internal right primer: TTTGAGCAATTCTGGACTAAAAA. Internal WT amplicon: 1270 bp. Deletion size: 448 bp. Deletion left flank: GACGTGAAGGCTTCACGAATGTGTTGGAGC. Deletion right flank: ACAGAAAAATGGGCGGGGCACAGTTTTGCA. Insertion Sequence: AGAAAAAT."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00020284(mel-46) | WBGene00020284(mel-46) | WB-STRAIN:WBStrain00037674 | WormBase (WB) | WB | available | WB-STRAIN:VC3108, CGC_VC3108 | 2026-08-15 09:33:31 | 0 | |||
|
VC3112 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037677 | Caenorhabditis elegans | C41A3.1(ok3769) X. | C41A3.1. External left primer: AAGCTTGGCGATCAGGTAGA. External right primer: CAGTTGACTCAATTTCCGCA. Internal left primer: ACGGCATAATACCGAACCAG. Internal right primer: TGCTCGTCAACAATGTTCGT. Internal WT amplicon: 1141 bp. Deletion size: 689 bp. Deletion left flank: CTCAATCCGACTCTGCGATGGAGGATATTT. Deletion right flank: GATCTGCCAGCTATTTGCTTGTGGGTTTGA.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00016558(pks-1) | WBGene00016558(pks-1) | WB-STRAIN:WBStrain00037677 | WormBase (WB) | WB | available | WB-STRAIN:VC3112, CGC_VC3112 | 2026-08-15 09:33:31 | 0 | |||
|
VC3121 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037683 | Caenorhabditis elegans | T07D10.1(gk3249) I; F59E12.3(gk3183) II; Y116A8C.5(gk3250) IV; unc-83(gk3251) gkDf35 V; gkDf32 X. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain is homozygous for a deletion (gk3183) in F59E12.3, detectable by PCR using the following primers. External left primer: GCATGCAAGAAATGCAAGAA. External right primer: TGAAGTCGCGCACAAATAAG. Internal left primer: TCACAAATGGAAACGTGTGG. Internal right primer: CAACGAGGCCAAAGTGATTT. Internal WT amplicon: 1320 bp. Deletion size: 585 bp. Deletion left flank: GAACTGACAACAAGTATCTCAACCTACACG. Deletion right flank: CCCCCGTTTATGCGCCCAGGGCATCCCACA. Validation: gk3183 passed by CGH. Other deletions (gkDf32, gkDf35, gk3249, gk3250, gk3251) identified by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006815(unc-83)|WBGene00011581(T07D10.1)|WBGene00013786(nep-24)|WBGene00019119(F59E12.3) | WBGene00006815(unc-83), WBGene00011581(T07D10.1), WBGene00013786(nep-24), WBGene00019119(F59E12.3) | WB-STRAIN:WBStrain00037683 | WormBase (WB) | WB | available | WB-STRAIN:VC3121, CGC_VC3121 | 2026-08-15 09:33:31 | 0 | |||
|
VC3118 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037681 | Caenorhabditis elegans | M05B5.2(ok3716)/szT1 [lon-2(e678)] I; +/szT1 X. | M05B5.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3716 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGGCAGTTTCAGGGTTCAAA. External right primer: CTAAGGCACTTGGCTTTTGC. Internal left primer: GGGAGGAAATTTCAAAAATGA. Internal right primer: AAAAATTTAACGCGTCGCTG. Internal WT amplicon: 1169 bp. Deletion size: 569 bp. Deletion left flank: GGAATGGCAAATTGACAGCATGAGGGTTTC. Deletion right flank: TTTTTGGGATGTTCAGCGACGCGTTAAATT. Insertion Sequence: TTT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00003056(lon-2)|WBGene00010870(let-522) | WBGene00003056(lon-2), WBGene00010870(let-522) | WB-STRAIN:WBStrain00037681 | WormBase (WB) | WB | available | WB-STRAIN:VC3118, CGC_VC3118 | 2026-08-15 09:33:31 | 0 | |||
|
VC3054 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037648 | Caenorhabditis elegans | F52B11.2(ok3718) IV/nT1 [qIs51] (IV;V). | F52B11.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3718 homozygotes (early- to mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTCCTGAAATATGGCGGAGA. External right primer: TCTTCTGGCCCTTCAACAGT. Internal left primer: ACACGAAGCACTGGCTTTTT. Internal right primer: GTCCGACAGTCCGTTCGT. Internal WT amplicon: 1267 bp. Deletion size: 518 bp. Deletion left flank: AATGTATTATTTTCCATTTTCCGAATTTTT. Deletion right flank: CGGATTCAAGGGCACCGAACCGTATCCAGT. Insertion Sequence: TT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00009925(F52B11.2) | WBGene00009925(F52B11.2) | WB-STRAIN:WBStrain00037648 | WormBase (WB) | WB | available | WB-STRAIN:VC3054, CGC_VC3054 | 2026-08-15 09:33:30 | 0 | |||
|
VC3042 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037642 | Caenorhabditis elegans | C06A12.3(ok3746) IV. | C06A12.3. External left primer: CAATGCAACGCCAATTGTTA. External right primer: CTCATCAATGCCTTGCTCCT. Internal left primer: TCCATTGTTTGAAGAGTGCTG. Internal right primer: CGAATTGGCTAAAAACTCGAA. Internal WT amplicon: 1192 bp. Deletion size: 336 bp. Deletion left flank: TATGTTCCATTGTTTGAAGAGTGCTGTTCT. Deletion right flank: TGAATAGAAAACGTCACGAAGTGGTGAGTT.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00007357(C06A12.3) | WBGene00007357(C06A12.3) | WB-STRAIN:WBStrain00037642 | WormBase (WB) | WB | available | WB-STRAIN:VC3042, CGC_VC3042 | 2026-08-15 09:33:30 | 0 | |||
|
VC3041 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037641 | Caenorhabditis elegans | F48C1.4(ok3745) I. | F48C1.4. External left primer: AACGATAGGAGACACGGTGG. External right primer: TGTGGTTGTTTTCGTTGCAT. Internal left primer: CAAGTTGAGAGTCCGCAGTG. Internal right primer: ACCATAAACTTGTTCGCGCT. Internal WT amplicon: 1143 bp. Deletion size: 523 bp. Deletion left flank: TTAGACAACTAACCATAGAGCGTGCAAATC. Deletion right flank: TGTTTCAGTGTTCTCCTTCCTGAAAAAAAA.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WB-STRAIN:WBStrain00037641 | WormBase (WB) | WB | available | WB-STRAIN:VC3041, CGC_VC3041 | 2026-08-15 09:33:30 | 0 | |||||
|
VC3046 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037646 | Caenorhabditis elegans | aly-1(ok3754) IV. | C01F6.5. External left primer: CAACTCCCCCAAATTGGTAA. External right primer: GACGAAGGGATGATATGGGA. Internal left primer: TTTTTGATGTCACCTACCTATTCTA. Internal right primer: TTTGTTCGCCGTTCAATATG. Internal WT amplicon: 1251 bp. Deletion size: 617 bp. Deletion left flank: TCTCCAGATACTCCATCCACCTAGTCTATC. Deletion right flank: CGTGAACTTCAACGAGCACGGAAAACCAGT.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000120(aly-1) | WBGene00000120(aly-1) | WB-STRAIN:WBStrain00037646 | WormBase (WB) | WB | available | WB-STRAIN:VC3046, CGC_VC3046 | 2026-08-15 09:33:30 | 0 | |||
|
VC3049 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037647 | Caenorhabditis elegans | hel-1(ok3698)/mT1 II; +/mT1 [dpy-10(e128)] III. | C26D10.2. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3698 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CAACCAAGTTCTGGCCATCT. External right primer: TTCCATTCTCCTTCCACCTG. Internal left primer: GGCGGAGAACATCATCACTT. Internal right primer: TTTCGGATCGTTTCGCTACT. Internal WT amplicon: 1141 bp. Deletion size: 721 bp. Deletion left flank: TGTCGCACTCGTCCAGGACGAAGTACTTGA. Deletion right flank: GAAATTTAGTAAATAACCTCACAAAAACAG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001072(dpy-10)|WBGene00001840(hel-1) | WBGene00001072(dpy-10), WBGene00001840(hel-1) | WB-STRAIN:WBStrain00037647 | WormBase (WB) | WB | available | WB-STRAIN:VC3049, CGC_VC3049 | 2026-08-15 09:33:30 | 0 | |||
|
VC3075 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037659 | Caenorhabditis elegans | tsp-3(ok3729) III. | Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y39E4B.4. External left primer: AAACCGCATTTGTCCGAATA. External right primer: TGCCCCCACTAACCAATATC. Internal left primer: TGTCTTAAAGCAAACGTGCAA. Internal right primer: ACTACTGCCGGCTCTATCGG. Internal WT amplicon: 1181 bp. Deletion size: 351 bp. Deletion left flank: GTTTTGATAAAGGCTTCGAATCGGAAATTC. Deletion right flank: AGGCTCCATACTTTCTGTTTATGGTTATCT." | WBGene00006629(tsp-3) | WBGene00006629(tsp-3) | WB-STRAIN:WBStrain00037659 | WormBase (WB) | WB | available | WB-STRAIN:VC3075, CGC_VC3075 | 2026-08-15 09:33:30 | 0 | |||
|
VC3062 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037654 | Caenorhabditis elegans | F25H8.2(ok3636) IV/nT1 [qIs51] (IV;V). | F25H8.2. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3636 homozygotes (sterile). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATGCAAACATGCTCCAATGA. External right primer: ATTATCCGATCTGGCAGGTG. Internal left primer: AACAAACGACACTCCGATTTC. Internal right primer: ATCTCGTTTTCGCCCTCTGT. Internal WT amplicon: 1333 bp. Deletion size: 333 bp. Deletion left flank: GAATGATTAGATTTCTAGCGTAATGTTCAC. Deletion right flank: AGAAGTTTTATAGGCATCGATGATACCCAT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00009132(F25H8.2) | WBGene00009132(F25H8.2) | WB-STRAIN:WBStrain00037654 | WormBase (WB) | WB | available | WB-STRAIN:VC3062, CGC_VC3062 | 2026-08-15 09:33:30 | 0 | |||
|
VC3059 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037651 | Caenorhabditis elegans | irg-8(ok3738) V. | Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK6.11. External left primer: ATCAGTCATAAGGCGATGGG. External right primer: CCATTTCAATAAACCGGTCG. Internal left primer: AAGGCTTCAAGGCTGTCAGA. Internal right primer: GTGGCTCGGTTTCACACTTT. Internal WT amplicon: 1209 bp. Deletion size: 496 bp. Deletion left flank: CAGCGTACAGATATGCCAGAGCAGTAGAGT. Deletion right flank: TAAATATTATACGGCGGGTAAACTTTAAAA." | WBGene00022645(irg-8) | WBGene00022645(irg-8) | WB-STRAIN:WBStrain00037651 | WormBase (WB) | WB | available | PMID:32009302 PMID:32560629 |
WB-STRAIN:VC3059, CGC_VC3059 | 2026-08-15 09:33:30 | 0 | ||
|
VC3060 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037652 | Caenorhabditis elegans | +/szT1 [lon-2(e678)] I; C33A11.1(ok3681)/szT1 X. | C33A11.1. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3681 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCTGGTTGTCCTTTGCTGTT. External right primer: CTGTTACGCTGTGCTGGAAA. Internal left primer: ACATGGGTTTGTCCCTTTTT. Internal right primer: CCCCCATAATTTTCATATCACG. Internal WT amplicon: 1298 bp. Deletion size: 1022 bp. Deletion left flank: TCATTTTTATTTGAATCATCAACTTTTAAA. Deletion right flank: AGCTCAAGATGAAAAAAGAAAAAGAGCAGG. Insertion Sequence: ATATTTTGACTTCCTTTTTTATTTTTTTTTTCT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00003056(lon-2)|WBGene00007877(nfki-1) | WBGene00003056(lon-2), WBGene00007877(nfki-1) | WB-STRAIN:WBStrain00037652 | WormBase (WB) | WB | available | WB-STRAIN:VC3060, CGC_VC3060 | 2026-08-15 09:33:30 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.