Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
ebax-1(gk5864[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00052085 | Caenorhabditis elegans | ebax-1(gk5864[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 6362 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: TCTAGAGGTTTTCCATCTATAAGTGAGCCG. Right flanking sequence: AGGCAATCGTGAACAAGATGAATAGTCCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004140(ebax-1)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004140(ebax-1), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00052085 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:46:28 | 0 | ||||
|
cpt-2(gk5869[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00052086 | Caenorhabditis elegans | cpt-2(gk5869[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 3129 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: CTCTCAATTTTCAGATGCTTCGTTCCTCAA. Right flanking sequence: CGTGGTCACCTTCTCGATCCGAAATAATTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00011122(cpt-2) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00011122(cpt-2) | WB-STRAIN:WBStrain00052086 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:46:28 | 0 | ||||
|
cri-3(gk5946[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00052129 | Caenorhabditis elegans | cri-3(gk5946[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1930 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: ATACGGAGACAGTTCCTTTCGAATGTGTGT. Right flanking sequence: CGGTTCTGCAAGACTCTCGTCGCCTATGCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00010303(cri-3) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00010303(cri-3) | WB-STRAIN:WBStrain00052129 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:46:29 | 0 | ||||
|
D1044.6(gk5941[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00052124 | Caenorhabditis elegans | D1044.6(gk5941[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. | Homozygous viable. Deletion of 7375 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: CGAAAAGGGAATCTTGCACCGTGCCAGATT. Right flanking sequence: ACTATTAAAACCAACATTATTTTCAAAGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00052124 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:46:29 | 0 | ||||
|
clec-207(gk5908[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00052092 | Caenorhabditis elegans | clec-207(gk5908[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. | Homozygous viable. Deletion of 1278 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: ATTATTTTCCCGATCTCCATATAAAAACCG. Right flanking sequence: ACGAAAATTTGTTGTTTAAAAAAACTTGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00018096(clec-207) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00018096(clec-207) | WB-STRAIN:WBStrain00052092 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:46:28 | 0 | ||||
|
C18A11.4(gk5909[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00052093 | Caenorhabditis elegans | C18A11.4(gk5909[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. | Homozygous viable. Deletion of 2028 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: TCGCAATAACCAATTTTACAAAACTAGAGG. Right flanking sequence: TGGGTTGATTTAAATTAAATATCATGTTAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00052093 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:46:28 | 0 | ||||
|
sqrd-1(ok3696) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00052078 | Caenorhabditis elegans | sqrd-1(ok3696) IV. | Made_by: Vancouver KO Group|"sqrd-1. Homozygous viable deletion, detectable by nested PCR. External left primer: TCCGTTGTCCTGCTCTTTTT. External right primer: CCTGTAATGACCCACCATCC. Internal left primer: CCAGATATCATACAAACCCCG. Internal right primer: CCAGTTTTATCGACAAATGCC. Internal WT amplicon: 1346 bp. Deletion size: 850 bp. Deletion left flank: GAAATCCGCGGAAGCTATTTTGTACCAGAT. Deletion right flank: CGTTTCCAATAAATCGTTAAAAATAAAACT."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00008538(sqrd-1) | WBGene00008538(sqrd-1) | WB-STRAIN:WBStrain00052078 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:46:28 | 0 | ||||
|
VC4527 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00052079 | Caenorhabditis elegans | EMPTY | EMPTY | WB-STRAIN:WBStrain00052079 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:46:28 | 0 | ||||||
|
pigt-1(gk5929[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00052112 | Caenorhabditis elegans | pigt-1(gk5929[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1486 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: AGAATGCAATGATAGCCAAAAGAATCGCCC. Right flanking sequence: TAAACCTAAAATCAACACGTAGCTCGTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00008918(pigt-1) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00008918(pigt-1) | WB-STRAIN:WBStrain00052112 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:46:29 | 0 | ||||
|
F57A8.1(gk3231) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00052072 | Caenorhabditis elegans | F57A8.1(gk3231) V. | F57A8.1. Homozygous viable deletion, detectable by nested PCR. External left primer: GCAAGTCGAAGAAACTTCCG. External right primer: CAAAATGTCCATCATTCCCC. Internal left primer: TCCGTGCGAAATTATGTTCA. Internal right primer: AACCTTTCCGTTTCATCACG. Internal WT amplicon: 2669 bp. Deletion size: 2229 bp. Deletion left flank: GCAAAAAGTTGTTTCAATGCAGAATAATTT. Deletion right flank: ATATCAAATAAGCGGGATTAAGCGACTTAC. Insetion sequence at break: GCAGAATACATATTCATTAGATAAATA.Validation: gk3231 confirmed by CGH.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00010177(F57A8.1) | WBGene00010177(F57A8.1) | WB-STRAIN:WBStrain00052072 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:46:28 | 0 | ||||
|
Y108F1.5(ok3700) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00052075 | Caenorhabditis elegans | Y108F1.5(ok3700) X. | Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y108F1.5. Homozygous viable deletion, detectable by nested PCR. External left primer: CACAGCTGAAACCGATGCTA. External right primer: GCCACCACTAGGGAAATTGA. Internal left primer: TCAGGGCATGATGAGAGTCA. Internal right primer: TGGATCAATTTTCAGCCACC. Internal WT amplicon: 1261 bp. Deletion size: 839 bp. Deletion left flank: TTTTTGAAAAACCTACTAATGCCCGCGACT. Deletion right flank: ACTGTAGCCCCAAAAGTACGCAAACACGGA. Insertion sequence at break: CTACCCTAAGAGTCCAGTTTTCAGGTTTCTAGTCGAATTTCGACCAGAATCGGGT." | WBGene00022433(Y108F1.5) | WBGene00022433(Y108F1.5) | WB-STRAIN:WBStrain00052075 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:46:28 | 0 | ||||
|
C27H6.9(gk5935[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00052118 | Caenorhabditis elegans | C27H6.9(gk5935[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 882 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: ATTTGATTCCAGATAAATCAGATCATGTCT. Right flanking sequence: TGAAGATGAAATGATGAGGACATTAGAAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00052118 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:46:29 | 0 | ||||
|
F25G6.8(gk5930[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00052113 | Caenorhabditis elegans | F25G6.8(gk5930[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. | Homozygous viable. Deletion of 623 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: AAATGAGGATGAAATACAATGGAAAGCCCA. Right flanking sequence: TGGGAATATGTTGTTCAACTGCCGACATTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00052113 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:46:29 | 0 | ||||
|
npp-20(gk5931[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00052114 | Caenorhabditis elegans | npp-20(gk5931[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 5424 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: AGAGAAAAAGAAGGAAAATCATAAAATATC. Right flanking sequence: TTCTCGTGCGCCAAGGAACGTGGATTTAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00003806(npp-20)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00003806(npp-20), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00052114 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:46:29 | 0 | ||||
|
twk-34(gk5933[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00052116 | Caenorhabditis elegans | twk-34(gk5933[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. | Homozygous viable. Deletion of 5542 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: TTTATTTACCACCTGTTCACAGTCCATGTT. Right flanking sequence: AGGAAAAAATTTAACGCATTCTGACAAAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006686(twk-34)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006686(twk-34), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00052116 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:46:29 | 0 | ||||
|
cbs-1(gk5787[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00052082 | Caenorhabditis elegans | cbs-1(gk5787[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ X. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 3433 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TGCCTATCAGTCTATAGTTTTCATTATCCA. Right flanking sequence: AATGTTTTTGTCACGAAAGTTAAATAAGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. [NOTE: a user has reported that gk5787 homozygotes are viable but extremely slow growing, taking about 5 to 7 days to reach adulthood.] Deletion of 3433 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TGCCTATCAGTCTATAGTTTTCATTATCCA. Right flanking sequence: AATGTTTTTGTCACGAAAGTTAAATAAGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00013866(cbs-1) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00013866(cbs-1) | WB-STRAIN:WBStrain00052082 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:46:28 | 0 | ||||
|
flp-14(gk1055) III; hpSi38. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00052187 | Caenorhabditis elegans | flp-14(gk1055) III; hpSi38. | hpSi38 [flp-14(+) + NeoR]. Superficially wild-type. Neomycin-resistant. hpSi38 is a single copy miniMos insertion a wild-type genomic fragment containing flp-14 and fully rescues the flp-14 mutant phenotype. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782 | WBGene00001457(flp-14) | WBGene00001457(flp-14) | WB-STRAIN:WBStrain00052187 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:46:30 | 0 | ||||
|
ujIs113 (pie-1p::mCherry::H2B; nhr-2p::mCherry::his-24::let858 3UTR; unc-119(+)) II; wgIs727 (ceh-83::TY1::EGFP::3xFLAG + unc-119(+)) Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00052220 | Caenorhabditis elegans | ujIs113 (pie-1p::mCherry::H2B; nhr-2p::mCherry::his-24::let858 3UTR; unc-119(+)) II; wgIs727 (ceh-83::TY1::EGFP::3xFLAG + unc-119(+)) | Processed manually from the January AFP strain emails that failed parsing | WB-STRAIN:WBStrain00052220 | WormBase (WB) | WB | unknown | PMID:34312566 | WormBase | 2026-10-17 11:46:30 | 0 | |||||
|
ujIs113 (pie-1p::mCherry::H2B; nhr-2p::mCherry::his-24::let858 3UTR; unc-119(+)) II; wgIs593 (ceh-88::TY1::EGFP::3xFLAG + unc-119(+)) Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00052221 | Caenorhabditis elegans | ujIs113 (pie-1p::mCherry::H2B; nhr-2p::mCherry::his-24::let858 3UTR; unc-119(+)) II; wgIs593 (ceh-88::TY1::EGFP::3xFLAG + unc-119(+)) | Processed manually from the January AFP strain emails that failed parsing | WB-STRAIN:WBStrain00052221 | WormBase (WB) | WB | unknown | PMID:34312566 | WormBase | 2026-10-17 11:46:30 | 0 | |||||
|
lin-15(n765) X; hpIs675. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00052189 | Caenorhabditis elegans | lin-15(n765) X; hpIs675. | hpIs675 [rgef-1p::GCaMP6s::3xNLS::mNeptune + lin-15(+)]. Worms express GCaMP6s and mNeptune in all neuronal nuclei. Pan-neuronal imaging strain; suitable for rapid whole-brain imaging due to brightness, good signal to noise ratio, and relative resistance to photo-bleaching. Reference: Susoy V, et al. Cell. 2021 Sep 30;184(20):5122-5137.e17. PMID: 34534446|"Made_by: Mei Zhen's lab" | WBGene00003004(lin-15) | WBGene00003004(lin-15) | WB-STRAIN:WBStrain00052189 | WormBase (WB) | WB | unknown | PMID:34534446 PMID:36712331 |
WormBase | 2026-10-17 11:46:30 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
