Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00037514
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00019322(ahcy-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00019322(ahcy-1)
Availability: available
Source References: EMPTY
Synonyms: ahcy-1(ok3601) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2731, CGC_VC2731
Notes: K02F2.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3601 homozygotes (mid- to late-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACGAGGAATACGAATGGTGC. External right primer: CGAAATGAGTGAAGCGTTGA. Internal left primer: CAAGGATGGACAACCACTCA. Internal right primer: CGGGTAGATGGGGAACAATA. Internal WT amplicon: 1126 bp. Deletion size: 715 bp. Deletion left flank: AAAGGGATCTGCTGCTTCCCTCAAGGCTTT. Deletion right flank: AAATTGTATTGCCCTCAAACTTCATATGAT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037514 Copy
http://www.wormbase.org/db/get?name=WBStrain00037515
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00015591(cyk-7)
Genomic Alteration: WBGene00000254(bli-4), WBGene00015591(cyk-7)
Availability: available
Source References: EMPTY
Synonyms: C08C3.4(ok3550) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2733, CGC_VC2733
Notes: C08C3.4. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3550 homozygotes (phenotype uncharacterized). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTACTTTTATGCCGGCCAAC. External right primer: AGCACTAGAAATGCGCCAGT. Internal left primer: TGTCGACGAGAACTGACATTG. Internal right primer: CTTTTCTTCAATTTCCGCGA. Internal WT amplicon: 1184 bp. Deletion size: 589 bp. Deletion left flank: GCTGTTTGGGTCACATTGAGACATGGCGCA. Deletion right flank: AGTGGTTTCCTCATTGGGCAGAAGGTGATG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037515 Copy
http://www.wormbase.org/db/get?name=WBStrain00037566
Source Database: WormBase (WB)
Affected Genes: WBGene00001063(dpy-1)|WBGene00020115(mboa-6)
Genomic Alteration: WBGene00001063(dpy-1), WBGene00020115(mboa-6)
Availability: available
Source References: EMPTY
Synonyms: mboa-6(gk1217)/sC1 [dpy-1(s2170)] III.
Alternate IDs: WB-STRAIN:VC2841, CGC_VC2841
Notes: Mutagen:UV/TMP|"R155.1. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and gk1217 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTTTAGCAAATTTTTGCGGG. External right primer: AAGTACGCAAACACCTTGGC. Internal left primer: GCTAACTCGGCCTTTACACG. Internal right primer: TTTGGAAACCCGTTGGATTA. Internal WT amplicon: 2401 bp. Deletion size: 1464 bp. Deletion left flank: GTCGATTGGACCCAAAAAATAGAATTTTCA. Deletion right flank: GTGAAAAAGTACAAGAAATTCAACTTTTTT."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037566 Copy
http://www.wormbase.org/db/get?name=WBStrain00037564
Source Database: WormBase (WB)
Affected Genes: WBGene00020274(T05H4.11)|WBGene00020275(atp-4)
Genomic Alteration: WBGene00020274(T05H4.11), WBGene00020275(atp-4)
Availability: available
Source References: EMPTY
Synonyms: T05H4.11&atp-4(ok2678) V/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC2839, CGC_VC2839
Notes: T05H4.11. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2678 homozygotes (early- to mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGATTTTGAAGCTCGACGTG. External right primer: CGTAATGGCCTCATTCGTTT. Internal left primer: ATTCGAATGGAACCGAGTCA. Internal right primer: TTTCCCGTTTGTAACCTCCA. Internal WT amplicon: 2683 bp. Deletion size: 1414 bp. Deletion left flank: TTGTGTTTCAAATCGGACACTCTGCAAAAT. Deletion right flank: CCTTAGCAGCTTCAAAGTTAGTTGGGAGCT. Insertion Sequence: TCGTTTATTT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037564 Copy
http://www.wormbase.org/db/get?name=WBStrain00037569
Source Database: WormBase (WB)
Affected Genes: WBGene00003795(npp-9)|WBGene00020381(T09B4.7)
Genomic Alteration: WBGene00003795(npp-9), WBGene00020381(T09B4.7)
Availability: available
Source References: EMPTY
Synonyms: T09B4.7(gk1215) I; npp-9(gk3059) III.
Alternate IDs: WB-STRAIN:VC2846, CGC_VC2846
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"T09B4.7, F59A2.1. The allele gk1215 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: CGTCTTTCACTCGCCTTTTC. External right primer: CAAAATGGAGAGTACCCGGA. Internal left primer: TATTCTGTATGACGCCGCAC. Internal right primer: CCGGCCTGATCTGAGAGTAA. Internal WT amplicon: 2551 bp. Deletion size: 661 bp. Deletion left flank: AAAGAAATAAAGCTCCAGATGATATCACGT. Deletion right flank: GGAAAGCAACTTATCATTTCCCATACCAAC. The allele gk3059 was identified by CGH but not confirmed by PCR. Left flanking probe: TTCCATTCTCAATATTTGAAGGGAGTGTCTCCTCCGAAATGGTCACCTGG. Right flanking probe: CAGAACATGGTTTGCTCTCCTTCTTCTCCAGTTTTCACCTCGACAAGATC. Left deleted probe: GTCTCCTCCGAAATGGTCACCTGGTCTCGTCGCATAACAACTCTCCACGA. Right deleted probe: CGTTGGCATAAATGTAGAGTTTTGAACGATTGCAGAACATGGTTTGCTCT."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037569 Copy
http://www.wormbase.org/db/get?name=WBStrain00037568
Source Database: WormBase (WB)
Affected Genes: WBGene00002211(kin-30)
Genomic Alteration: WBGene00002211(kin-30)
Availability: available
Source References: EMPTY
Synonyms: kin-30(gk1214) V.
Alternate IDs: WB-STRAIN:VC2845, CGC_VC2845
Notes: M01B2.1. Identified by PCR, validated by CGH. External left primer: CAAATCAGCGGAAATACGGT. External right primer: CTGCCCGCAATTAGAATGTT. Internal left primer: AAGATTCGTCCGATCTGTGG. Internal right primer: TTTAGGCCGAAGAGTTGCAT. Internal WT amplicon: 2534 bp. Deletion size: 806 bp. Deletion left flank: GATCTCAGGAGTGTTTTGAAATACACACCA. Deletion right flank: CATCATAGCAAAAAATCTTATTACAGGTTT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037568 Copy
http://www.wormbase.org/db/get?name=WBStrain00037573
Source Database: WormBase (WB)
Affected Genes: WBGene00016557(ceh-84)
Genomic Alteration: WBGene00016557(ceh-84)
Availability: available
Source References: EMPTY
Synonyms: C40D2.4(gk1276) II.
Alternate IDs: WB-STRAIN:VC2858, CGC_VC2858
Notes: C40D2.4. External left primer: CATACCCAAAGGTCTGGTGG. External right primer: GCACAACCTGTGCATGTAGG. Internal left primer: CCACAGACCCGCTATTAAGG. Internal right primer: TTCCCAACACTTCAACGTCA. Internal WT amplicon: 1685 bp. Deletion size: 518 bp. Deletion left flank: TCTCCTCAAATGCTGAAAGTGAATAAAGAA. Deletion right flank: CAAAAAATATTTTTCAAAAGATAACATAAA. Insertion Sequence: AGGTGATCTAC.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037573 Copy
http://www.wormbase.org/db/get?name=WBStrain00037571
Source Database: WormBase (WB)
Affected Genes: WBGene00019275(rpac-40)
Genomic Alteration: WBGene00019275(rpac-40)
Availability: available
Source References: EMPTY
Synonyms: H43I07.2(ok3654) V/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC2854, CGC_VC2854
Notes: H43I07.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3654 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGACCTACGACGAATGCACC. External right primer: GGCAATTAACCGAAATCGAA. Internal left primer: AAATCCAAGTGGCAATGGTC. Internal right primer: GCAAATTGCCGAAAAAGAAA. Internal WT amplicon: 1310 bp. Deletion size: 688 bp. Deletion left flank: TTCTGCCGCTTCGTGTGGATCCACGTGGAT. Deletion right flank: ACATCTACCTATATTCAGTATATTTAGACT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037571 Copy
http://www.wormbase.org/db/get?name=WBStrain00037574
Source Database: WormBase (WB)
Affected Genes: WBGene00011169(R09D1.13)
Genomic Alteration: WBGene00011169(R09D1.13)
Availability: available
Source References: EMPTY
Synonyms: R09D1.13(gk3177) II.
Alternate IDs: WB-STRAIN:VC2859, CGC_VC2859
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain is homozygous for a deletion (gk3177) in R09D1.13, detectable by PCR using the following primers. External left primer: GCAATCGGGATGTTCTGAAT. External right primer: TGTTGGAGAAACTGTGCGAG. Internal left primer: ACAACGAAACATCGTCGGAT. Internal right primer: ATAAATATGGATGCCGCCAA. Internal WT amplicon: 2530 bp. Deletion size: approximately 1400 bp. Validation: gk3177 passed by CGH. Left deleted probe: AGGATCAATTTCGACTGGAATGTTGCCTATACTAATATTATCTCGAATGC. Right deleted probe: AATTAATATAACTAGATCCATTGCCATTTTCGGTTTGGCTGGAACATATA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037574 Copy
http://www.wormbase.org/db/get?name=WBStrain00037575
Source Database: WormBase (WB)
Affected Genes: WBGene00010719(K09E4.1)
Genomic Alteration: WBGene00010719(K09E4.1)
Availability: available
Source References: EMPTY
Synonyms: K09E4.1(gk1223) II.
Alternate IDs: WB-STRAIN:VC2860, CGC_VC2860
Notes: K09E4.1. Identified by PCR, validated by CGH. External left primer: TCGGCAAATGTGGTTTTGTA. External right primer: CGAGTTCTCTTCCTCAACCG. Internal left primer: ACACAATGGAGCAGCATCAG. Internal right primer: GGCAATCTTGTGGAACACCT. Internal WT amplicon: 1905 bp. Deletion size: 753 bp. Deletion left flank: CAAATTTTTTTGCCGATTTGCCGGAAATTT. Deletion right flank: GCGATGCGGAACAAGTTCACGCTTGGGACG.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037575 Copy
http://www.wormbase.org/db/get?name=WBStrain00037578
Source Database: WormBase (WB)
Affected Genes: WBGene00013543(Y75B8A.6)
Genomic Alteration: WBGene00013543(Y75B8A.6)
Availability: available
Source References: EMPTY
Synonyms: Y75B8A.6(ok2294) III.
Alternate IDs: WB-STRAIN:VC2864, CGC_VC2864
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y75B8A.6. External left primer: ACGGATCCCTGAACAGAATG. External right primer: TATATTCACGGGGTTCTGGC. Internal left primer: TTGCTGGAGAGAAAAACGGT. Internal right primer: GGAAACCAGAAATCCGTGAA. Internal WT amplicon: 3060 bp. Deletion size: 903 bp. Deletion left flank: ATACGAAAAAATTCAAAAATTCAAAAAGGA. Deletion right flank: TATATTGAACTCGTTTCACATCAAAATGCA."
Proper citation: RRID:WB-STRAIN:WBStrain00037578 Copy
http://www.wormbase.org/db/get?name=WBStrain00037579
Source Database: WormBase (WB)
Affected Genes: WBGene00010983(mocs-1)
Genomic Alteration: WBGene00010983(mocs-1)
Availability: available
Source References: EMPTY
Synonyms: R03A10.3(ok3439) X.
Alternate IDs: WB-STRAIN:VC2873, CGC_VC2873
Notes: R03A10.3. External left primer: TGCTGGAGTAGAGCGGGTAT. External right primer: GCAGAGAGCCTGAAAATTGC. Internal left primer: CCTTGTGGAAGGCCTTGTT. Internal right primer: GCACAGCCCTGATTCCTACT. Internal WT amplicon: 1181 bp. Deletion size: 621 bp. Deletion left flank: CAGTTTTTTTCCGTTTCACTTACCACATCG. Deletion right flank: CCCAACTACAGAATGATGCGAATCGTAGAG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037579 Copy
http://www.wormbase.org/db/get?name=WBStrain00037580
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00009701(egg-3)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00009701(egg-3)
Availability: available
Source References: EMPTY
Synonyms: egg-3(ok3651)/mIn1 [mIs14 dpy-10(e128)] II.
Alternate IDs: WB-STRAIN:VC2876, CGC_VC2876
Notes: F44F4.2. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3651 homozygotes (sterile giving unfertilized eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AATAAGCCGGTGTGATACGG. External right primer: TCGATGTCTGATTGCAGCTC. Internal left primer: ATCGATTTGAAGCGAAGGC. Internal right primer: GTCAATTGAATCCGGAGCAT. Internal WT amplicon: 1211 bp. Deletion size: 555 bp. Deletion left flank: ATGGAATGATCCAAAACGAAGAGATTCATT. Deletion right flank: ACTGAACTTCCCCGGCTCAACAAGCAGTGA. Insertion Sequence: TCTCGAAGAGATTCATTCTC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037580 Copy
http://www.wormbase.org/db/get?name=WBStrain00037583
Source Database: WormBase (WB)
Affected Genes: WBGene00006829(unc-101)|WBGene00009305(metl-17)
Genomic Alteration: WBGene00006829(unc-101), WBGene00009305(metl-17)
Availability: available
Source References: EMPTY
Synonyms: F32A7.4(ok3586)/hIn1 [unc-101(sy241)] I.
Alternate IDs: WB-STRAIN:VC2896, CGC_VC2896
Notes: F32A7.4. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok3586 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATTGTGCGTTATTTCGGAGC. External right primer: CTTTCATCCGTCATTGCTCA. Internal left primer: GACTATTTCTTCGACATTTTATTGC. Internal right primer: GGGTAGATTTTGAAAAAGAAACG. Internal WT amplicon: 1238 bp. Deletion size: 539 bp. Deletion left flank: ATTTGAGGTAAACGAAAAAATAATATAAAA. Deletion right flank: GGCAAGATTAGCCCCAAACTATGCAGAAAT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037583 Copy
http://www.wormbase.org/db/get?name=WBStrain00037584
Source Database: WormBase (WB)
Affected Genes: WBGene00006829(unc-101)|WBGene00013597(gpi-1)
Genomic Alteration: WBGene00006829(unc-101), WBGene00013597(gpi-1)
Availability: available
Source References: EMPTY
Synonyms: gpi-1(ok3599)/hIn1 [unc-101(sy241)] I.
Alternate IDs: WB-STRAIN:VC2897, CGC_VC2897
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y87G2A.8. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok3599 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGTCTGAGCCTCAACCAAAA. External right primer: CTCTCACTCAAAATGCGGGT. Internal left primer: CAGAATTTTGAGAAAATCCAACG. Internal right primer: AGTTTGTAGCCCCTCAGCCT. Internal WT amplicon: 1205 bp. Deletion size: 621 bp. Deletion left flank: ACCAAATCGGACCGAATGTGCACTTCGTGT. Deletion right flank: ATCAGTTGATTCATCAGGGTACTCGACTGA."
Proper citation: RRID:WB-STRAIN:WBStrain00037584 Copy
http://www.wormbase.org/db/get?name=WBStrain00037547
Source Database: WormBase (WB)
Affected Genes: WBGene00018123(F36H12.9)
Genomic Alteration: WBGene00018123(F36H12.9)
Availability: available
Source References: EMPTY
Synonyms: F36H12.9(gk1123) IV.
Alternate IDs: WB-STRAIN:VC2795, CGC_VC2795
Notes: F36H12.9. Identified by PCR, validated by CGH. External left primer: TGTTGTGGAAGTGCAAGAGG. External right primer: CGTATCGGTTAGTCGGCATT. Internal left primer: GCCTCAGCGATATGGAGAAG. Internal right primer: AGAAATCCTTTGTCGATGCG. Internal WT amplicon: 1008 bp. Deletion size: 761 bp. Deletion left flank: TACTCCGCCTCAGCGATATGGAGAAGTTTG. Deletion right flank: ATATATTGTTTTCAGTACTTGGATACTCTT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037547 Copy
http://www.wormbase.org/db/get?name=WBStrain00037546
Source Database: WormBase (WB)
Affected Genes: WBGene00020388(T10B5.2)
Genomic Alteration: WBGene00020388(T10B5.2)
Availability: available
Source References: EMPTY
Synonyms: T10B5.2(gk1153) V.
Alternate IDs: WB-STRAIN:VC2793, CGC_VC2793
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"T10B5.2. External left primer: CTCGGTTTGTACCATGGCTT. External right primer: AATTTTGCGTATTGCGAACC. Internal left primer: GATCTTCCTCATCGTGCCAT. Internal right primer: AGGACATCCGGGAGAGACTT. Internal WT amplicon: 2414 bp. Deletion size: 851 bp. Deletion left flank: AAATGATAGAAGGTCTGCTGGTACTGTGTT. Deletion right flank: GTCCCTCCATCCATCTTCGATATTTTTGGT. Insertion Sequence: TTGTTTGTGT."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037546 Copy
http://www.wormbase.org/db/get?name=WBStrain00037550
Source Database: WormBase (WB)
Affected Genes: WBGene00005724(srv-13)|WBGene00010772(K11D9.3)|WBGene00011327(hlh-34)
Genomic Alteration: WBGene00005724(srv-13), WBGene00010772(K11D9.3), WBGene00011327(hlh-34)
Availability: available
Source References: EMPTY
Synonyms: K11D9.3(gk3223) III; srv-13(gk3224) IV; hlh-34(gk1211) V.
Alternate IDs: WB-STRAIN:VC2802, CGC_VC2802
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain is homozygous for a deletion (gk1211) in T01D3.2, detectable by PCR using the following primers. External left primer: GTGAAGCCGAAGGATCATGT. External right primer: CGTCTTTGCTTTCTTTTCCG. Internal left primer: GAAGAACTTTGCATCGAGGG. Internal right primer: TGTCCAACAATTTCCAACGA. Internal WT amplicon: 1737 bp. Deletion size: 301 bp. Deletion left flank: TTAAAAAACAGAAAAAAAATTAAAAATATA. Deletion right flank: CATCTCCGCGCCTGTCCAGTATCACAAAGA. Validation: gk1211 passed by CGH. Other deletions (gk3223, gk3224) identified by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037550 Copy
http://www.wormbase.org/db/get?name=WBStrain00037554
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00008860(romo-1)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00008860(romo-1)
Availability: available
Source References: EMPTY
Synonyms: F15D4.3(ok3521)/mT1 II; +/mT1 [dpy-10(e128)] III.
Alternate IDs: WB-STRAIN:VC2819, CGC_VC2819
Notes: F15D4.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3521 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGATTCGGCAAGAGAGGTCA. External right primer: AAAGTTTTGCTCCTGTGCGT. Internal left primer: TAATAATCCCTTGAGCCCCC. Internal right primer: AACGATTTCTTTCACAAAGTGGA. Internal WT amplicon: 1187 bp. Deletion size: 378 bp. Deletion left flank: CTTCTCTTCTCCCTGTGTGTACCAGTGTAC. Deletion right flank: TCGAATCTGGAAATTTTGAAAATAAATTAG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037554 Copy
http://www.wormbase.org/db/get?name=WBStrain00037552
Source Database: WormBase (WB)
Affected Genes: WBGene00013727(Y111B2A.1)
Genomic Alteration: WBGene00013727(Y111B2A.1)
Availability: available
Source References: EMPTY
Synonyms: Y111B2A.1(gk1164) III.
Alternate IDs: WB-STRAIN:VC2805, CGC_VC2805
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y111B2A.1. External left primer: GAAGCTCGAAGAGTGGGATG. External right primer: AGTGTATGCAGCGTGTTTGC. Internal left primer: CCTCTTTGAATTACCGCCAA. Internal right primer: TTTCAGATGAAACGTGCGAG. Internal WT amplicon: 2262 bp. Deletion size: 614 bp. Deletion left flank: TTAATTAATTTCACTGATTTACGCCTGTAA. Deletion right flank: AAAATTGTTTCCAGCCGCTGCGACAATGAT."
Proper citation: RRID:WB-STRAIN:WBStrain00037552 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.