Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
hda-5(hd7070[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055648 | Caenorhabditis elegans | hda-5(hd7070[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | Homozygous viable. Deletion of 2776 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACATATACCTATTTTCTCCTTGTTTTCCCC; Right flanking sequence: TGGAAAGATCCTCGCTATATTAGAAGGTGG. sgRNA #1: TGATGTTTGACCGATTATGG; sgRNA #2: CTCCTCAGCCAAATTTGCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00009663(hda-5) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00009663(hda-5) | WB-STRAIN:WBStrain00055648 | WormBase (WB) | WB | unknown | 2026-08-15 09:38:48 | 0 | ||||
|
pph-1(hd7066[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055645 | Caenorhabditis elegans | pph-1(hd7066[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. | Homozygous viable. Deletion of 2500 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTATTTTTTCGTTTTCAAAAAATAGTACCG; Right flanking sequence: CTGTCCCGGGTCCTTTCTTTTCTCCCGATT. sgRNA #1: CCTAGGTATTTTTGTTTTCT; sgRNA #2: CCCTTCAAACCATCACTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" | WBGene00003514(myo-2)|WBGene00004083(pph-1)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004083(pph-1), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00055645 | WormBase (WB) | WB | unknown | 2026-08-15 09:38:48 | 0 | ||||
|
Y51B9A.9(hd7068[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055647 | Caenorhabditis elegans | Y51B9A.9(hd7068[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 1571 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGCCCAAATTCGGTCAGTGTACTGAAAATC; Right flanking sequence: CAATAATGCTGAGGAAAAAAGCTTCGAATA. sgRNA #1: TCATCCTTCATTTGTCTGGG; sgRNA #2: GAATTTTCAGGCAACACTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00055647 | WormBase (WB) | WB | unknown | 2026-08-15 09:38:48 | 0 | ||||
|
asp-3(hd7060[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055639 | Caenorhabditis elegans | asp-3(hd7060[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | Homozygous viable. Deletion of 2624 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGAGCATGATGAACTTGATGAGATAAACTG; Right flanking sequence: CGGAGGACAAAACTTCGATCTTCAAGGAAA. sgRNA #1: CTTGATGAGATAAACTGATG; sgRNA #2: AACATCACCTTCAACCTCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" | WBGene00000216(asp-3)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00000216(asp-3), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00055639 | WormBase (WB) | WB | unknown | 2026-08-15 09:38:48 | 0 | ||||
|
dzDf1 lem-4(ve691[myo-2p::GFP])/tmC25 [unc-5(tm9708)] IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054622 | Caenorhabditis elegans | dzDf1 lem-4(ve691[myo-2p::GFP])/tmC25 [unc-5(tm9708)] IV. | dzDf1 [IV:506328 - 698511 deleted]. Pick wild-type GFP+ to maintain. Heterozygotes are wildtype GFP+ and segregate into dead eggs (dzDf1 homozygotes), wild-type GFP+ (Heterozygotes), and Unc (tmC25 homozygotes).|"Made_by: Leo T. H. Tang" | WBGene00003514(myo-2)|WBGene00006745(unc-5)|WBGene00021945(lem-4) | WBGene00003514(myo-2), WBGene00006745(unc-5), WBGene00021945(lem-4) | WB-STRAIN:WBStrain00054622 | WormBase (WB) | WB | unknown | 2026-08-15 09:38:31 | 0 | ||||
|
mir-57(umn34[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR LoX511I + Lox2272]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054692 | Caenorhabditis elegans | mir-57(umn34[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR LoX511I + Lox2272]) II. | Made_by: Julie Knott & Marcus Vargas|"mir-57 pre-miRNA deletion strain deletion allele in which mir-57 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]" | WBGene00003285(mir-57)|WBGene00003514(myo-2)|WBGene00005016(sqt-1) | WBGene00003285(mir-57), WBGene00003514(myo-2), WBGene00005016(sqt-1) | WB-STRAIN:WBStrain00054692 | WormBase (WB) | WB | unknown | 2026-08-15 09:38:33 | 0 | ||||
|
F20A1.1(ve597[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047493 | Caenorhabditis elegans | F20A1.1(ve597[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. | Homozygous viable. Deletion of 544 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: actaatcaccactacgtgtcgtcacaattc ; Right flanking sequence: aagactacagtaacgggtgaaatatcgaga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00047493 | WormBase (WB) | WB | unknown | 2026-08-15 09:36:23 | 0 | ||||
|
F20A1.10(ve598[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047494 | Caenorhabditis elegans | F20A1.10(ve598[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. | Homozygous viable. Deletion of 527 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: atgtatatatgtgcatttcgagcaacaaca ; Right flanking sequence: cggtttttatacatccaaattgagatcggt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00047494 | WormBase (WB) | WB | unknown | 2026-08-15 09:36:23 | 0 | ||||
|
clx-1(ve581[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047487 | Caenorhabditis elegans | clx-1(ve581[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 2495 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: atgggaatgttgtggaactttgaatctatg ; Right flanking sequence: gtttttcgccattttgattcgggttcgact. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00000551(clx-1)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00000551(clx-1), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00047487 | WormBase (WB) | WB | unknown | 2026-08-15 09:36:23 | 0 | ||||
|
melo-3(ve584[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047489 | Caenorhabditis elegans | melo-3(ve584[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. | C25D7.1. Homozygous viable. Deletion of 584 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Left flanking Sequence: tacaagtattctggaaaaaagccgaaccaa ; Right flanking sequence: tgcaaaaatatcttacCTCTGGATCAATTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 584 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tacaagtattctggaaaaaagccgaaccaa ; Right flanking sequence: tgcaaaaatatcttacCTCTGGATCAATTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00007714(melo-3) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00007714(melo-3) | WB-STRAIN:WBStrain00047489 | WormBase (WB) | WB | unknown | 2026-08-15 09:36:23 | 0 | ||||
|
bgnt-1.1(gk3637[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047532 | Caenorhabditis elegans | bgnt-1.1(gk3637[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 900 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TAATTGTTCTGTGTTTGCTACCCGGTTAAA; Right flanking sequence: AAACAAGTCAAAAGAACAATTTGTCAAATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00047532 | WormBase (WB) | WB | unknown | 2026-08-15 09:36:23 | 0 | ||||
|
sek-4(gk3642[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047534 | Caenorhabditis elegans | sek-4(gk3642[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. | Homozygous viable. Deletion of 490 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GGTATACGCGAAAATTACACACATTACAGT; Right flanking sequence: AAGCATTTAAAAAGTTTTTGTATTCTGTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00018035(sek-4) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00018035(sek-4) | WB-STRAIN:WBStrain00047534 | WormBase (WB) | WB | unknown | 2026-08-15 09:36:23 | 0 | ||||
|
pry-1(gk3681[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I; F56E10.1(gk3701) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047536 | Caenorhabditis elegans | pry-1(gk3681[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I; F56E10.1(gk3701) V. | Homozygous viable. Deletion of 720 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TAGGGGCCCCTCCCGGTAGCCGGTCGAGCG; Right flanking sequence: GGATTTTTCTGCGAAATTTGGATTTAGCTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Primary deletion of 720 bp in pry-1 with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TAGGGGCCCCTCCCGGTAGCCGGTCGAGCG; Right flanking sequence: GGATTTTTCTGCGAAATTTGGATTTAGCTT. Strain carries secondary 5-bp deletion in F56E10.1, with flanking sequences GGCGCCGGCGGTGAAGAGGATGAGGACAAT and GGATTCAGAAGAAGAAGATGAAGAAGACTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004202(pry-1)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00018975(picd-1) | WBGene00003514(myo-2), WBGene00004202(pry-1), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00018975(picd-1) | WB-STRAIN:WBStrain00047536 | WormBase (WB) | WB | unknown | 2026-08-15 09:36:23 | 0 | ||||
|
skr-17(ve564[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047470 | Caenorhabditis elegans | skr-17(ve564[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. | Homozygous viable. Deletion of 718 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Left flanking Sequence: agggtgttttaaaatttgaatttgccgccg ; Right flanking sequence: ATGGGATGATTAAttttctgttactatctt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00004823(skr-17)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00004823(skr-17), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00047470 | WormBase (WB) | WB | unknown | 2026-08-15 09:36:22 | 0 | ||||
|
+/nT1 [umnIs49] IV; nol-56(ve565[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047471 | Caenorhabditis elegans | +/nT1 [umnIs49] IV; nol-56(ve565[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. | Made_by: RG KO Group|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Lvl. Deletion of 2013 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, dead GFP+ non-mKate larvae (ve574 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tgcgcaaaactgtacCTTCTCCTTAACCTC ; Right flanking sequence: Tggtgtaagaacctgaaaaatcatttattc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Lvl. Deletion of 2013 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, dead GFP+ non-mKate larvae (ve574 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tgcgcaaaactgtacCTTCTCCTTAACCTC ; Right flanking sequence: Tggtgtaagaacctgaaaaatcatttattc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00010627(nol-56) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00010627(nol-56) | WB-STRAIN:WBStrain00047471 | WormBase (WB) | WB | unknown | 2026-08-15 09:36:22 | 0 | ||||
|
+/hT1 [umnIs58] I; erfa-1(ve567[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [unc-42(e270)] V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047473 | Caenorhabditis elegans | +/hT1 [umnIs58] I; erfa-1(ve567[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [unc-42(e270)] V. | Made_by: RG KO Group|"umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous larval arrest. Deletion of 2016 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve567 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: cagcacaaatagaatATGAGCGCTCCCGCA ; Right flanking sequence: GGTGGATGTTTCTACTCGCAATTCCAATGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006778(unc-42)|WBGene00006789(unc-54)|WBGene00020269(erfa-1) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006778(unc-42), WBGene00006789(unc-54), WBGene00020269(erfa-1) | WB-STRAIN:WBStrain00047473 | WormBase (WB) | WB | unknown | 2026-08-15 09:36:22 | 0 | ||||
|
vep-1(ve560[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047466 | Caenorhabditis elegans | vep-1(ve560[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. | Made_by: RG KO Group|"umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. B0261.1. Homozygous Let. Deletion of 4055 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve560 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: AATGCACAATTTGCATCTCCAAATCCGCCA ; Right flanking sequence: ccgttattttacgactgtcaaatctccatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006778(unc-42)|WBGene00006789(unc-54)|WBGene00015091(vep-1) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006778(unc-42), WBGene00006789(unc-54), WBGene00015091(vep-1) | WB-STRAIN:WBStrain00047466 | WormBase (WB) | WB | unknown | 2026-08-15 09:36:22 | 0 | ||||
|
C05C8.7(ve562[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047468 | Caenorhabditis elegans | C05C8.7(ve562[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. | Made_by: RG KO Group|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Emb. Deletion of 3553 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (ve562 homozygotes and aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: attgaaaaaagtgttggtattaccccgtaa ; Right flanking sequence: TATGGTGTCTTCTGATCAATTTGGAAACTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00047468 | WormBase (WB) | WB | unknown | 2026-08-15 09:36:22 | 0 | ||||
|
anat-1(ve576[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047482 | Caenorhabditis elegans | anat-1(ve576[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 9928 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gtctctttctattttaccttctttccggca ; Right flanking sequence: tgtcccaatttcacattattatatattttg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00015938(anat-1) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00015938(anat-1) | WB-STRAIN:WBStrain00047482 | WormBase (WB) | WB | unknown | 2026-08-15 09:36:22 | 0 | ||||
|
+/szT1 [lon-2(e678) umnIs61] I; bcat-1(ve578[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/szT1 X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047484 | Caenorhabditis elegans | +/szT1 [lon-2(e678) umnIs61] I; bcat-1(ve578[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/szT1 X. | Made_by: RG KO Group|"umnIs61 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)] I. Homozygous Let. Deletion of 2704 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead larvae (ve578 homozygotes), Lon non-GFP mKate2+ males (szT1 hemizygotes), and dead eggs (szT1 homozygotes and aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ttaacacccgtatcattatcatttccatgc ; Right flanking sequence: cccaacttccttccaccccctcaaaaagcg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00001149(bcat-1)|WBGene00003056(lon-2)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00001149(bcat-1), WBGene00003056(lon-2), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00047484 | WormBase (WB) | WB | unknown | 2026-08-15 09:36:23 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.