Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00037315
Source Database: WormBase (WB)
Affected Genes: WBGene00006070(str-2)
Genomic Alteration: WBGene00006070(str-2)
Availability: available
Source References: EMPTY
Synonyms: str-2(ok3089) V.
Alternate IDs: WB-STRAIN:VC2413, CGC_VC2413
Notes: C50C10.7. External left primer: TCGACCTGTCAAACATCGAA. External right primer: CGCATTTGTGAACCTGTTTG. Internal left primer: AAATCCTCGTCGATAACTTTTGA. Internal right primer: GCACACATATGGGTCTGCTTT. Internal WT amplicon: 1213 bp. Deletion size: 409 bp. Deletion left flank: TCTATCATCTCAAGCTTTTTGGTCAGCCAA. Deletion right flank: TGAATCGAAGTCCGGAAACAAGTAGTTATT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037315 Copy
http://www.wormbase.org/db/get?name=WBStrain00037320
Source Database: WormBase (WB)
Affected Genes: WBGene00020086(npr-24)
Genomic Alteration: WBGene00020086(npr-24)
Availability: available
Source References: PMID:38302462, PMID:38446031
Synonyms: R106.2(ok3192) X.
Alternate IDs: WB-STRAIN:VC2421, CGC_VC2421
Notes: Made_by: Vancouver KO Group|"R106.2. External left primer: ATTTTACTGGTGTCCTGCGG. External right primer: AAAACGGCAAATTCGAAAAA. Internal left primer: GCATGATCTGCTTATCCGGT. Internal right primer: CCGCAATTCGGTCTAAAACT. Internal WT amplicon: 1241 bp. Deletion size: 738 bp. Deletion left flank: CAACCAACGCTGTGTTGGTTTGTACATATA. Deletion right flank: AAGTTTAACATCTCAAAAGAATTGACTAAG. Insertion Sequence: T."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037320 Copy
http://www.wormbase.org/db/get?name=WBStrain00037401
Source Database: WormBase (WB)
Affected Genes: WBGene00000422(ced-8)|WBGene00003056(lon-2)
Genomic Alteration: WBGene00000422(ced-8), WBGene00003056(lon-2)
Availability: available
Source References: EMPTY
Synonyms: +/szT1 [lon-2(e678)] I; ced-8(ok3213)/szT1 X.
Alternate IDs: WB-STRAIN:VC2547, CGC_VC2547
Notes: F08F1.5. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3213 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CAAATATCAGCACCAATGCG. External right primer: TGCAATGTGCTCCTATGCTC. Internal left primer: CTTACCTGCAAAACCGCTTC. Internal right primer: CAATCTTTCATTTTTGGGCG. Internal WT amplicon: 1179 bp. Deletion size: 649 bp. Deletion left flank: CTTTCTCAATCTTACCTGCAAAACCGCTTC. Deletion right flank: GTGACCGCAAACTGATTAGTCTCTTGAAAT. Insertion Sequence: ACCGCAAAC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037401 Copy
http://www.wormbase.org/db/get?name=WBStrain00037366
Source Database: WormBase (WB)
Affected Genes: WBGene00008842(chil-28)|WBGene00011802(T16G1.9)|WBGene00013872(ZC374.2)
Genomic Alteration: WBGene00008842(chil-28), WBGene00011802(T16G1.9), WBGene00013872(ZC374.2)
Availability: available
Source References: EMPTY
Synonyms: F15A4.8(gk3032) II; T16G1.9(gk3033) V; ZC374.2(gk1152) X.
Alternate IDs: WB-STRAIN:VC2499, CGC_VC2499
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZC374.2, F15A4.8, T16G1.9. The allele gk1152 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: TTGGAAGTTTTGGCAGGAAT. External right primer: CTTGCGTTAATCGCATGTGT. Internal left primer: TCCAATTTGAGCGATCAGTG. Internal right primer: AGGACGCGCAGATTGTTAGT. Internal WT amplicon: 2448 bp. Deletion size: 842 bp. Deletion left flank: TCAATGTTCTACTTTTTAACGCATTTACGT. Deletion right flank: GGTTTAGAAGATAACTTTAAATGTTTAAAC. The allele gk3032 was identified by CGH but not confirmed by PCR. Left flanking probe: TCCATAATTCTAGCGACGTTGAAGTTTATCTGTGGTTCATGGCCGGAGTA. Right flanking probe: GTCGTAATTCAGAAAGAAACTCTGAAACCATGTGCTGGTTGGATTCCAGC. Left deleted probe: ATCTGTGGTTCATGGCCGGAGTACAGTGGAAGAGGACCAATTAGTGAACT. Right deleted probe: TTGAGATTAGATACTGGGTTTGCAGAGCCTGTCGTAATTCAGAAAGAAAC. The allele gk3033 was identified by CGH but not confirmed by PCR. Left flanking probe: CGAAGCAGGAGGTCACTTGTTTTGCTTTCCGATAATAATTGAATATCTAG. Right flanking probe: GGATAACCAAACATGTTGAAATTGGCCACGGACGCGTAGCATTCTAAAGA. Left deleted probe: GAAACAAAAGGCCAGGCGATAGAAAATAAGGCAGTAAACGTCAATTAATA. Right deleted probe: AATAATTGTTTACCCATTTCTTGTAAATCATGAGGCAATAGTGCTCTGAA."
Proper citation: RRID:WB-STRAIN:WBStrain00037366 Copy
http://www.wormbase.org/db/get?name=WBStrain00037371
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00004214(ptp-2)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00004214(ptp-2)
Availability: available
Source References: EMPTY
Synonyms: ptp-2(ok3252)/mIn1 [mIs14 dpy-10(e128)] II.
Alternate IDs: WB-STRAIN:VC2508, CGC_VC2508
Notes: F59G1.5. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3252 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CAGTATCTGTCGAAACGCGA. External right primer: CCTGAGAAAATGGGAAGCAA. Internal left primer: CGACGACCAGTTAATGCTGA. Internal right primer: TGATGACGTGGAAGAAGTGC. Internal WT amplicon: 1163 bp. Deletion size: 652 bp. Deletion left flank: GGTCGACGACCAGTTAATGCTGAAAAGAAT. Deletion right flank: TCGTTGTTCATTGTAGTGCTGGAATTGGTA. Insertion Sequence: CG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037371 Copy
http://www.wormbase.org/db/get?name=WBStrain00037374
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00007402(ugt-60)
Genomic Alteration: WBGene00000254(bli-4), WBGene00007402(ugt-60)
Availability: available
Source References: PMID:38488606
Synonyms: ugt-60
Alternate IDs: WB-STRAIN:VC2512, CGC_VC2512
Notes: C07A9.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3248 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAAGGTTTCGGACTTGTTGC. External right primer: CGCATCCACTTTCTTCAGGT. Internal left primer: CTGAGAGCATCGCGGATAGT. Internal right primer: TGACGCGTCTAGCTCAATTTT. Internal WT amplicon: 1354 bp. Deletion size: 525 bp. Deletion left flank: TATAGCCTCCATGTGCAATCATTAATTTCA. Deletion right flank: AACCTCGATAGAACAAATTCTCGTCAACGA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037374 Copy
http://www.wormbase.org/db/get?name=WBStrain00037372
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00022739(toe-1)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00022739(toe-1)
Availability: available
Source References: EMPTY
Synonyms: ZK430.1(ok3194)/mIn1 [mIs14 dpy-10(e128)] II.
Alternate IDs: WB-STRAIN:VC2509, CGC_VC2509
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"ZK430.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3194 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TATTTCAGGAGTTGCGGGAC. External right primer: GTCCCATTTCTCTCCGTTCA. Internal left primer: TGATACAGAATTCGCCAACG. Internal right primer: CATTCGGTCGCCTTATTGAT. Internal WT amplicon: 1374 bp. Deletion size: 812 bp. Deletion left flank: TCGAAAAGCTTCTTCTGGAACTTTCTCCGT. Deletion right flank: CTTATAGAAACTATTGAAGATGCTTCGATT."
Proper citation: RRID:WB-STRAIN:WBStrain00037372 Copy
http://www.wormbase.org/db/get?name=WBStrain00037373
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00013122(impt-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00013122(impt-1)
Availability: available
Source References: EMPTY
Synonyms: Y52B11A.2(ok3233) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2511, CGC_VC2511
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y52B11A.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3233 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCGAGCCTCACTCAAAACT. External right primer: AGTGGTCCATATCTCCGTCG. Internal left primer: GAAAATGTTCACGAAACGCA. Internal right primer: GGAGCAGAAAGAGGTGCTTC. Internal WT amplicon: 1301 bp. Deletion size: 675 bp. Deletion left flank: ACTAATAGAAAATTCAAAAATTGGGTGAGA. Deletion right flank: AAGATCCTAAAACTATTTTAAACTTCTTTT. Insertion Sequence: TAGATCCTAAAACAA."
Proper citation: RRID:WB-STRAIN:WBStrain00037373 Copy
http://www.wormbase.org/db/get?name=WBStrain00037378
Source Database: WormBase (WB)
Affected Genes: WBGene00003804(npp-18)
Genomic Alteration: WBGene00003804(npp-18)
Availability: available
Source References: EMPTY
Synonyms: npp-18(ok3278) III.
Alternate IDs: WB-STRAIN:VC2517, CGC_VC2517
Notes: Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y43F4B.4. External left primer: CAGCACATTGCCCTACTGAA. External right primer: TTTTCAATGGAAAGGCAAGC. Internal left primer: GAAAACGTACCCCCTCGATT. Internal right primer: TATTCGGCTCCGAGGAGAG. Internal WT amplicon: 1259 bp. Deletion size: 338 bp. Deletion left flank: TGGATGAAAAGTCTTTAAAATGTATCAATT. Deletion right flank: GAAGATTTTTATTTCCAGGTTTCATTCGAT. Insertion Sequence: AA."
Proper citation: RRID:WB-STRAIN:WBStrain00037378 Copy
http://www.wormbase.org/db/get?name=WBStrain00037377
Source Database: WormBase (WB)
Affected Genes: WBGene00020687(ruvb-2)
Genomic Alteration: WBGene00020687(ruvb-2)
Availability: available
Source References: EMPTY
Synonyms: ruvb-2(ok3232) IV/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC2515, CGC_VC2515
Notes: T22D1.10. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3232 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTGAATTCACGGTTTTGTCG. External right primer: ATTTTCCAGGTTGAACGCAC. Internal left primer: GGGACAGAGCGTTTCCAAT. Internal right primer: CGCTAGACAAGCTGCAGGAC. Internal WT amplicon: 1244 bp. Deletion size: 457 bp. Deletion left flank: AACGAAAAGCATTCGATATCAAGCATATGA. Deletion right flank: CGCATTGTGAGTTTTCCGACCTTTGGTCCC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037377 Copy
http://www.wormbase.org/db/get?name=WBStrain00037381
Source Database: WormBase (WB)
Affected Genes: WBGene00003180(med-1)
Genomic Alteration: WBGene00003180(med-1)
Availability: available
Source References: EMPTY
Synonyms: med-1(ok3216) X.
Alternate IDs: WB-STRAIN:VC2523, CGC_VC2523
Notes: T24D3.1. External left primer: CGCGTAAAATCCATGTTGTG. External right primer: TCTAGTGGGTGACAATCGCA. Internal left primer: CGTCCGAAGGCAAATAAAAG. Internal right primer: ATTTCGGCCCTTTTTGTCTC. Internal WT amplicon: 1163 bp. Deletion size: 630 bp. Deletion left flank: TTGAATCAGTTTTCATACTTTATTCCTTCT. Deletion right flank: ACATTTATATTTAATTCTTGTTCTCGATTT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037381 Copy
http://www.wormbase.org/db/get?name=WBStrain00037385
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00012713(bckd-1A)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00012713(bckd-1A)
Availability: available
Source References: EMPTY
Synonyms: +/mT1 II; Y39E4A.3(ok2650)/mT1 [dpy-10(e128)] III.
Alternate IDs: WB-STRAIN:VC2527, CGC_VC2527
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y39E4A.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2650 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GGGTGGAGCGTAATTTTTCA. External right primer: CGACATTTTGCGGACTTTTT. Internal left primer: GGCACGGTTTTCCTCTTTTT. Internal right primer: GTGGCTGGTGATTTTTCCAC. Internal WT amplicon: 1226 bp. Deletion size: 520 bp. Deletion left flank: TTTCTCCAGAAATATCGATTTTTTAAAAGC. Deletion right flank: CGGAAAGCGTCTCCTTCAACGGTAGAAGCC."
Proper citation: RRID:WB-STRAIN:WBStrain00037385 Copy
http://www.wormbase.org/db/get?name=WBStrain00037383
Source Database: WormBase (WB)
Affected Genes: WBGene00000166(apt-9)
Genomic Alteration: WBGene00000166(apt-9)
Availability: available
Source References: EMPTY
Synonyms: apt-9(ok3247) X.
Alternate IDs: WB-STRAIN:VC2525, CGC_VC2525
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"W04G3.4. External left primer: ATTGGTGGGCTGTTTCTTTG. External right primer: CAAGCAAAATTGGGGATGTT. Internal left primer: AAGTGGATCCAGAGAACCAAGA. Internal right primer: CGACAAAATATGTAAACCGGG. Internal WT amplicon: 1146 bp. Deletion size: 428 bp. Deletion left flank: CTGGCTGGGAAACGGCTCCCAGAGTAAGAA. Deletion right flank: AAAAAACAAAGCAATTATTCAAATTCTAAT. Insertion Sequence: AAA."
Proper citation: RRID:WB-STRAIN:WBStrain00037383 Copy
http://www.wormbase.org/db/get?name=WBStrain00037466
Source Database: WormBase (WB)
Affected Genes: WBGene00003533(nas-14)
Genomic Alteration: WBGene00003533(nas-14)
Availability: available
Source References: EMPTY
Synonyms: nas-14(ok3340) IV.
Alternate IDs: WB-STRAIN:VC2636, CGC_VC2636
Notes: F09E8.6. External left primer: TGCTCTTCGTATGTTGGCAG. External right primer: CAGGCCCAGAAATTTCGTTA. Internal left primer: TCAGACTGTGTCGTTGGAGG. Internal right primer: TTTGCATCCTATGATGTGTGC. Internal WT amplicon: 1218 bp. Deletion size: 407 bp. Deletion left flank: AGGGAATAATTGCTCACGAACTGATGCACG. Deletion right flank: GTGTCAAGTACGACGACTACAACTAAGAAA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037466 Copy
http://www.wormbase.org/db/get?name=WBStrain00037500
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00006728(ubq-2)|WBGene00014176(ZK1010.2)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00006728(ubq-2), WBGene00014176(ZK1010.2)
Availability: available
Source References: EMPTY
Synonyms: +/mT1 II; ZK1010.2&ubq-2(ok2028)/mT1 [dpy-10(e128)] III.
Alternate IDs: WB-STRAIN:VC2694, CGC_VC2694
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"ZK1010.2, ZK1010.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2028 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCTCCAATTCAGGTCGTTCC. External right primer: TCATATCGAATTCATCGGCA. Internal left primer: TCCAAATGTTTTCCCGAGAG. Internal right primer: CTGGACGCTTGTTCAGCATA. Internal WT amplicon: 2149 bp. Deletion size: 896 bp. Deletion left flank: TGAAGCAACTGGGCGTCTCTTCTTCATCTT. Deletion right flank: GATTTTTCTTTAGAGACTAGTTTCAAAGGT."
Proper citation: RRID:WB-STRAIN:WBStrain00037500 Copy
http://www.wormbase.org/db/get?name=WBStrain00037469
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00003842(oct-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00003842(oct-1)
Availability: available
Source References: EMPTY
Synonyms: oct-1(ok3339) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2641, CGC_VC2641
Notes: F52F12.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3339 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CATATGCCTCGTCCTGGAAC. External right primer: GGCCATGTTCATCAGAAGGT. Internal left primer: TTTCTTTACCACGAAGTAAGCG. Internal right primer: TCTGAATGTTTGAAAGTCGCA. Internal WT amplicon: 1354 bp. Deletion size: 696 bp. Deletion left flank: CATTGAAGTAGAGGCCAAACAACGAAATAT. Deletion right flank: TCTGAATTAAAAATGCTTAATTCAGAAGTG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037469 Copy
http://www.wormbase.org/db/get?name=WBStrain00037473
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00018016(lrr-1)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00018016(lrr-1)
Availability: available
Source References: PMID:33713117
Synonyms: lrr-1(ok3435)/mIn1 [mIs14 dpy-10(e128)] II.
Alternate IDs: WB-STRAIN:VC2646, CGC_VC2646
Notes: F33G12.4. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3435 homozygotes (sterile, no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAGTCCGATTTTGCAGCTTG. External right primer: TCCCCAGTGCTCTTTTATCG. Internal left primer: AACCATTTGATCATTGGCATT. Internal right primer: CCATGTGAAGTGGTTTTTGC. Internal WT amplicon: 1116 bp. Deletion size: 563 bp. Deletion left flank: AGGCTTTATCAGGTCTCCGTAAATCGATAG. Deletion right flank: GATTAACTCCGGCATTTGCTTTATAACGTG. Insertion Sequence: AC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037473 Copy
http://www.wormbase.org/db/get?name=WBStrain00037474
Source Database: WormBase (WB)
Affected Genes: WBGene00003056(lon-2)|WBGene00017241(pcyt-1)
Genomic Alteration: WBGene00003056(lon-2), WBGene00017241(pcyt-1)
Availability: available
Source References: EMPTY
Synonyms: +/szT1 [lon-2(e678)] I; F08C6.2(ok547)/szT1 X.
Alternate IDs: WB-STRAIN:VC2647, CGC_VC2647
Notes: F08C6.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok547 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CGATAACCGAAGACTTTCGC. External right primer: CCGTGTTTCCAACCAAATCT. Internal left primer: AGCGTTGCGCTTATCAATTT. Internal right primer: GGCGATAGGAACCAGTTGAA. Internal WT amplicon: 2670 bp. Deletion size: 2114 bp. Deletion left flank: TCAAAGAAAATAACTTTGGCAATGGCAGAA. Deletion right flank: ACAGGAACGACAGAAAATGTATCCGTATTT.|"Mutagen:TMP+UV"|"Mutagen:TMP/UV"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037474 Copy
http://www.wormbase.org/db/get?name=WBStrain00037472
Source Database: WormBase (WB)
Affected Genes: WBGene00017982(hpo-18)
Genomic Alteration: WBGene00017982(hpo-18)
Availability: available
Source References: PMID:38946472
Synonyms: F32D1.2(ok3436) V/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC2645, CGC_VC2645
Notes: F32D1.2. Homozygous lethal or sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3436 homozygotes (late-larval to sterile adult arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTGAATCCGAAGGTGTCTC. External right primer: GCAGCCCAGTCTGTGTTGTA. Internal left primer: GATCATCGTTATTTTCGCCG. Internal right primer: TATAGAGCCGGGCTGAAATG. Internal WT amplicon: 1263 bp. Deletion size: 791 bp. Deletion left flank: AATGTATCCAAATGGAATTATTCGAATACT. Deletion right flank: CTGGTGGGTCTCGCAACGACATGAAGGAGG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037472 Copy
http://www.wormbase.org/db/get?name=WBStrain00037477
Source Database: WormBase (WB)
Affected Genes: WBGene00006726(ubl-5)
Genomic Alteration: WBGene00006726(ubl-5)
Availability: available
Source References: PMID:37831769
Synonyms: ubl-5(ok3389) I.
Alternate IDs: WB-STRAIN:VC2654, CGC_VC2654
Notes: F46F11.4. External left primer: GGAGCGAAGAAAGAGGGAGT. External right primer: GTGCATGCGCCTTTAAGTTT. Internal left primer: GCAGAAATTAATGGGGTGGA. Internal right primer: GCGTCGAGTTGTGTGTTTTT. Internal WT amplicon: 1248 bp. Deletion size: 294 bp. Deletion left flank: TTTTTTTTTATTAAACAATAAAAAATGTAT. Deletion right flank: TCAAATTTTCAATTTGTTTCTAATATATAA.|"Supplementary_genotype ubl-5(ok3389) I"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037477 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.