Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
VC2413 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00037315 | Caenorhabditis elegans | str-2(ok3089) V. | C50C10.7. External left primer: TCGACCTGTCAAACATCGAA. External right primer: CGCATTTGTGAACCTGTTTG. Internal left primer: AAATCCTCGTCGATAACTTTTGA. Internal right primer: GCACACATATGGGTCTGCTTT. Internal WT amplicon: 1213 bp. Deletion size: 409 bp. Deletion left flank: TCTATCATCTCAAGCTTTTTGGTCAGCCAA. Deletion right flank: TGAATCGAAGTCCGGAAACAAGTAGTTATT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006070(str-2) | WBGene00006070(str-2) | WB-STRAIN:WBStrain00037315 | WormBase (WB) | WB | available | WB-STRAIN:VC2413, CGC_VC2413 | 2026-08-15 09:33:25 | 1 | |||
|
VC2421 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00037320 | Caenorhabditis elegans | R106.2(ok3192) X. | Made_by: Vancouver KO Group|"R106.2. External left primer: ATTTTACTGGTGTCCTGCGG. External right primer: AAAACGGCAAATTCGAAAAA. Internal left primer: GCATGATCTGCTTATCCGGT. Internal right primer: CCGCAATTCGGTCTAAAACT. Internal WT amplicon: 1241 bp. Deletion size: 738 bp. Deletion left flank: CAACCAACGCTGTGTTGGTTTGTACATATA. Deletion right flank: AAGTTTAACATCTCAAAAGAATTGACTAAG. Insertion Sequence: T."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00020086(npr-24) | WBGene00020086(npr-24) | WB-STRAIN:WBStrain00037320 | WormBase (WB) | WB | available | PMID:38302462 PMID:38446031 |
WB-STRAIN:VC2421, CGC_VC2421 | 2026-08-15 09:33:25 | 2 | ||
|
VC2547 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037401 | Caenorhabditis elegans | +/szT1 [lon-2(e678)] I; ced-8(ok3213)/szT1 X. | F08F1.5. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3213 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CAAATATCAGCACCAATGCG. External right primer: TGCAATGTGCTCCTATGCTC. Internal left primer: CTTACCTGCAAAACCGCTTC. Internal right primer: CAATCTTTCATTTTTGGGCG. Internal WT amplicon: 1179 bp. Deletion size: 649 bp. Deletion left flank: CTTTCTCAATCTTACCTGCAAAACCGCTTC. Deletion right flank: GTGACCGCAAACTGATTAGTCTCTTGAAAT. Insertion Sequence: ACCGCAAAC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000422(ced-8)|WBGene00003056(lon-2) | WBGene00000422(ced-8), WBGene00003056(lon-2) | WB-STRAIN:WBStrain00037401 | WormBase (WB) | WB | available | WB-STRAIN:VC2547, CGC_VC2547 | 2026-08-15 09:33:26 | 0 | |||
|
VC2499 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037366 | Caenorhabditis elegans | F15A4.8(gk3032) II; T16G1.9(gk3033) V; ZC374.2(gk1152) X. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZC374.2, F15A4.8, T16G1.9. The allele gk1152 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: TTGGAAGTTTTGGCAGGAAT. External right primer: CTTGCGTTAATCGCATGTGT. Internal left primer: TCCAATTTGAGCGATCAGTG. Internal right primer: AGGACGCGCAGATTGTTAGT. Internal WT amplicon: 2448 bp. Deletion size: 842 bp. Deletion left flank: TCAATGTTCTACTTTTTAACGCATTTACGT. Deletion right flank: GGTTTAGAAGATAACTTTAAATGTTTAAAC. The allele gk3032 was identified by CGH but not confirmed by PCR. Left flanking probe: TCCATAATTCTAGCGACGTTGAAGTTTATCTGTGGTTCATGGCCGGAGTA. Right flanking probe: GTCGTAATTCAGAAAGAAACTCTGAAACCATGTGCTGGTTGGATTCCAGC. Left deleted probe: ATCTGTGGTTCATGGCCGGAGTACAGTGGAAGAGGACCAATTAGTGAACT. Right deleted probe: TTGAGATTAGATACTGGGTTTGCAGAGCCTGTCGTAATTCAGAAAGAAAC. The allele gk3033 was identified by CGH but not confirmed by PCR. Left flanking probe: CGAAGCAGGAGGTCACTTGTTTTGCTTTCCGATAATAATTGAATATCTAG. Right flanking probe: GGATAACCAAACATGTTGAAATTGGCCACGGACGCGTAGCATTCTAAAGA. Left deleted probe: GAAACAAAAGGCCAGGCGATAGAAAATAAGGCAGTAAACGTCAATTAATA. Right deleted probe: AATAATTGTTTACCCATTTCTTGTAAATCATGAGGCAATAGTGCTCTGAA." | WBGene00008842(chil-28)|WBGene00011802(T16G1.9)|WBGene00013872(ZC374.2) | WBGene00008842(chil-28), WBGene00011802(T16G1.9), WBGene00013872(ZC374.2) | WB-STRAIN:WBStrain00037366 | WormBase (WB) | WB | available | WB-STRAIN:VC2499, CGC_VC2499 | 2026-08-15 09:33:26 | 0 | |||
|
VC2508 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037371 | Caenorhabditis elegans | ptp-2(ok3252)/mIn1 [mIs14 dpy-10(e128)] II. | F59G1.5. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3252 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CAGTATCTGTCGAAACGCGA. External right primer: CCTGAGAAAATGGGAAGCAA. Internal left primer: CGACGACCAGTTAATGCTGA. Internal right primer: TGATGACGTGGAAGAAGTGC. Internal WT amplicon: 1163 bp. Deletion size: 652 bp. Deletion left flank: GGTCGACGACCAGTTAATGCTGAAAAGAAT. Deletion right flank: TCGTTGTTCATTGTAGTGCTGGAATTGGTA. Insertion Sequence: CG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001072(dpy-10)|WBGene00004214(ptp-2) | WBGene00001072(dpy-10), WBGene00004214(ptp-2) | WB-STRAIN:WBStrain00037371 | WormBase (WB) | WB | available | WB-STRAIN:VC2508, CGC_VC2508 | 2026-08-15 09:33:26 | 0 | |||
|
VC2512 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037374 | Caenorhabditis elegans | ugt-60 | C07A9.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3248 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAAGGTTTCGGACTTGTTGC. External right primer: CGCATCCACTTTCTTCAGGT. Internal left primer: CTGAGAGCATCGCGGATAGT. Internal right primer: TGACGCGTCTAGCTCAATTTT. Internal WT amplicon: 1354 bp. Deletion size: 525 bp. Deletion left flank: TATAGCCTCCATGTGCAATCATTAATTTCA. Deletion right flank: AACCTCGATAGAACAAATTCTCGTCAACGA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000254(bli-4)|WBGene00007402(ugt-60) | WBGene00000254(bli-4), WBGene00007402(ugt-60) | WB-STRAIN:WBStrain00037374 | WormBase (WB) | WB | available | PMID:38488606 | WB-STRAIN:VC2512, CGC_VC2512 | 2026-08-15 09:33:26 | 0 | ||
|
VC2509 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037372 | Caenorhabditis elegans | ZK430.1(ok3194)/mIn1 [mIs14 dpy-10(e128)] II. | This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"ZK430.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3194 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TATTTCAGGAGTTGCGGGAC. External right primer: GTCCCATTTCTCTCCGTTCA. Internal left primer: TGATACAGAATTCGCCAACG. Internal right primer: CATTCGGTCGCCTTATTGAT. Internal WT amplicon: 1374 bp. Deletion size: 812 bp. Deletion left flank: TCGAAAAGCTTCTTCTGGAACTTTCTCCGT. Deletion right flank: CTTATAGAAACTATTGAAGATGCTTCGATT." | WBGene00001072(dpy-10)|WBGene00022739(toe-1) | WBGene00001072(dpy-10), WBGene00022739(toe-1) | WB-STRAIN:WBStrain00037372 | WormBase (WB) | WB | available | WB-STRAIN:VC2509, CGC_VC2509 | 2026-08-15 09:33:26 | 0 | |||
|
VC2511 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037373 | Caenorhabditis elegans | Y52B11A.2(ok3233) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y52B11A.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3233 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCGAGCCTCACTCAAAACT. External right primer: AGTGGTCCATATCTCCGTCG. Internal left primer: GAAAATGTTCACGAAACGCA. Internal right primer: GGAGCAGAAAGAGGTGCTTC. Internal WT amplicon: 1301 bp. Deletion size: 675 bp. Deletion left flank: ACTAATAGAAAATTCAAAAATTGGGTGAGA. Deletion right flank: AAGATCCTAAAACTATTTTAAACTTCTTTT. Insertion Sequence: TAGATCCTAAAACAA." | WBGene00000254(bli-4)|WBGene00013122(impt-1) | WBGene00000254(bli-4), WBGene00013122(impt-1) | WB-STRAIN:WBStrain00037373 | WormBase (WB) | WB | available | WB-STRAIN:VC2511, CGC_VC2511 | 2026-08-15 09:33:26 | 0 | |||
|
VC2517 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037378 | Caenorhabditis elegans | npp-18(ok3278) III. | Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y43F4B.4. External left primer: CAGCACATTGCCCTACTGAA. External right primer: TTTTCAATGGAAAGGCAAGC. Internal left primer: GAAAACGTACCCCCTCGATT. Internal right primer: TATTCGGCTCCGAGGAGAG. Internal WT amplicon: 1259 bp. Deletion size: 338 bp. Deletion left flank: TGGATGAAAAGTCTTTAAAATGTATCAATT. Deletion right flank: GAAGATTTTTATTTCCAGGTTTCATTCGAT. Insertion Sequence: AA." | WBGene00003804(npp-18) | WBGene00003804(npp-18) | WB-STRAIN:WBStrain00037378 | WormBase (WB) | WB | available | WB-STRAIN:VC2517, CGC_VC2517 | 2026-08-15 09:33:26 | 0 | |||
|
VC2515 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037377 | Caenorhabditis elegans | ruvb-2(ok3232) IV/nT1 [qIs51] (IV;V). | T22D1.10. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3232 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTGAATTCACGGTTTTGTCG. External right primer: ATTTTCCAGGTTGAACGCAC. Internal left primer: GGGACAGAGCGTTTCCAAT. Internal right primer: CGCTAGACAAGCTGCAGGAC. Internal WT amplicon: 1244 bp. Deletion size: 457 bp. Deletion left flank: AACGAAAAGCATTCGATATCAAGCATATGA. Deletion right flank: CGCATTGTGAGTTTTCCGACCTTTGGTCCC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00020687(ruvb-2) | WBGene00020687(ruvb-2) | WB-STRAIN:WBStrain00037377 | WormBase (WB) | WB | available | WB-STRAIN:VC2515, CGC_VC2515 | 2026-08-15 09:33:26 | 0 | |||
|
VC2523 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037381 | Caenorhabditis elegans | med-1(ok3216) X. | T24D3.1. External left primer: CGCGTAAAATCCATGTTGTG. External right primer: TCTAGTGGGTGACAATCGCA. Internal left primer: CGTCCGAAGGCAAATAAAAG. Internal right primer: ATTTCGGCCCTTTTTGTCTC. Internal WT amplicon: 1163 bp. Deletion size: 630 bp. Deletion left flank: TTGAATCAGTTTTCATACTTTATTCCTTCT. Deletion right flank: ACATTTATATTTAATTCTTGTTCTCGATTT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00003180(med-1) | WBGene00003180(med-1) | WB-STRAIN:WBStrain00037381 | WormBase (WB) | WB | available | WB-STRAIN:VC2523, CGC_VC2523 | 2026-08-15 09:33:26 | 0 | |||
|
VC2527 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037385 | Caenorhabditis elegans | +/mT1 II; Y39E4A.3(ok2650)/mT1 [dpy-10(e128)] III. | This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y39E4A.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2650 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GGGTGGAGCGTAATTTTTCA. External right primer: CGACATTTTGCGGACTTTTT. Internal left primer: GGCACGGTTTTCCTCTTTTT. Internal right primer: GTGGCTGGTGATTTTTCCAC. Internal WT amplicon: 1226 bp. Deletion size: 520 bp. Deletion left flank: TTTCTCCAGAAATATCGATTTTTTAAAAGC. Deletion right flank: CGGAAAGCGTCTCCTTCAACGGTAGAAGCC." | WBGene00001072(dpy-10)|WBGene00012713(bckd-1A) | WBGene00001072(dpy-10), WBGene00012713(bckd-1A) | WB-STRAIN:WBStrain00037385 | WormBase (WB) | WB | available | WB-STRAIN:VC2527, CGC_VC2527 | 2026-08-15 09:33:26 | 0 | |||
|
VC2525 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037383 | Caenorhabditis elegans | apt-9(ok3247) X. | This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"W04G3.4. External left primer: ATTGGTGGGCTGTTTCTTTG. External right primer: CAAGCAAAATTGGGGATGTT. Internal left primer: AAGTGGATCCAGAGAACCAAGA. Internal right primer: CGACAAAATATGTAAACCGGG. Internal WT amplicon: 1146 bp. Deletion size: 428 bp. Deletion left flank: CTGGCTGGGAAACGGCTCCCAGAGTAAGAA. Deletion right flank: AAAAAACAAAGCAATTATTCAAATTCTAAT. Insertion Sequence: AAA." | WBGene00000166(apt-9) | WBGene00000166(apt-9) | WB-STRAIN:WBStrain00037383 | WormBase (WB) | WB | available | WB-STRAIN:VC2525, CGC_VC2525 | 2026-08-15 09:33:26 | 0 | |||
|
VC2636 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037466 | Caenorhabditis elegans | nas-14(ok3340) IV. | F09E8.6. External left primer: TGCTCTTCGTATGTTGGCAG. External right primer: CAGGCCCAGAAATTTCGTTA. Internal left primer: TCAGACTGTGTCGTTGGAGG. Internal right primer: TTTGCATCCTATGATGTGTGC. Internal WT amplicon: 1218 bp. Deletion size: 407 bp. Deletion left flank: AGGGAATAATTGCTCACGAACTGATGCACG. Deletion right flank: GTGTCAAGTACGACGACTACAACTAAGAAA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00003533(nas-14) | WBGene00003533(nas-14) | WB-STRAIN:WBStrain00037466 | WormBase (WB) | WB | available | WB-STRAIN:VC2636, CGC_VC2636 | 2026-08-15 09:33:27 | 0 | |||
|
VC2694 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037500 | Caenorhabditis elegans | +/mT1 II; ZK1010.2&ubq-2(ok2028)/mT1 [dpy-10(e128)] III. | This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"ZK1010.2, ZK1010.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2028 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCTCCAATTCAGGTCGTTCC. External right primer: TCATATCGAATTCATCGGCA. Internal left primer: TCCAAATGTTTTCCCGAGAG. Internal right primer: CTGGACGCTTGTTCAGCATA. Internal WT amplicon: 2149 bp. Deletion size: 896 bp. Deletion left flank: TGAAGCAACTGGGCGTCTCTTCTTCATCTT. Deletion right flank: GATTTTTCTTTAGAGACTAGTTTCAAAGGT." | WBGene00001072(dpy-10)|WBGene00006728(ubq-2)|WBGene00014176(ZK1010.2) | WBGene00001072(dpy-10), WBGene00006728(ubq-2), WBGene00014176(ZK1010.2) | WB-STRAIN:WBStrain00037500 | WormBase (WB) | WB | available | WB-STRAIN:VC2694, CGC_VC2694 | 2026-08-15 09:33:28 | 0 | |||
|
VC2641 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037469 | Caenorhabditis elegans | oct-1(ok3339) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | F52F12.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3339 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CATATGCCTCGTCCTGGAAC. External right primer: GGCCATGTTCATCAGAAGGT. Internal left primer: TTTCTTTACCACGAAGTAAGCG. Internal right primer: TCTGAATGTTTGAAAGTCGCA. Internal WT amplicon: 1354 bp. Deletion size: 696 bp. Deletion left flank: CATTGAAGTAGAGGCCAAACAACGAAATAT. Deletion right flank: TCTGAATTAAAAATGCTTAATTCAGAAGTG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000254(bli-4)|WBGene00003842(oct-1) | WBGene00000254(bli-4), WBGene00003842(oct-1) | WB-STRAIN:WBStrain00037469 | WormBase (WB) | WB | available | WB-STRAIN:VC2641, CGC_VC2641 | 2026-08-15 09:33:28 | 0 | |||
|
VC2646 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037473 | Caenorhabditis elegans | lrr-1(ok3435)/mIn1 [mIs14 dpy-10(e128)] II. | F33G12.4. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3435 homozygotes (sterile, no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAGTCCGATTTTGCAGCTTG. External right primer: TCCCCAGTGCTCTTTTATCG. Internal left primer: AACCATTTGATCATTGGCATT. Internal right primer: CCATGTGAAGTGGTTTTTGC. Internal WT amplicon: 1116 bp. Deletion size: 563 bp. Deletion left flank: AGGCTTTATCAGGTCTCCGTAAATCGATAG. Deletion right flank: GATTAACTCCGGCATTTGCTTTATAACGTG. Insertion Sequence: AC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001072(dpy-10)|WBGene00018016(lrr-1) | WBGene00001072(dpy-10), WBGene00018016(lrr-1) | WB-STRAIN:WBStrain00037473 | WormBase (WB) | WB | available | PMID:33713117 | WB-STRAIN:VC2646, CGC_VC2646 | 2026-08-15 09:33:28 | 0 | ||
|
VC2647 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037474 | Caenorhabditis elegans | +/szT1 [lon-2(e678)] I; F08C6.2(ok547)/szT1 X. | F08C6.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok547 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CGATAACCGAAGACTTTCGC. External right primer: CCGTGTTTCCAACCAAATCT. Internal left primer: AGCGTTGCGCTTATCAATTT. Internal right primer: GGCGATAGGAACCAGTTGAA. Internal WT amplicon: 2670 bp. Deletion size: 2114 bp. Deletion left flank: TCAAAGAAAATAACTTTGGCAATGGCAGAA. Deletion right flank: ACAGGAACGACAGAAAATGTATCCGTATTT.|"Mutagen:TMP+UV"|"Mutagen:TMP/UV"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00003056(lon-2)|WBGene00017241(pcyt-1) | WBGene00003056(lon-2), WBGene00017241(pcyt-1) | WB-STRAIN:WBStrain00037474 | WormBase (WB) | WB | available | WB-STRAIN:VC2647, CGC_VC2647 | 2026-08-15 09:33:28 | 0 | |||
|
VC2645 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00037472 | Caenorhabditis elegans | F32D1.2(ok3436) V/nT1 [qIs51] (IV;V). | F32D1.2. Homozygous lethal or sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3436 homozygotes (late-larval to sterile adult arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTGAATCCGAAGGTGTCTC. External right primer: GCAGCCCAGTCTGTGTTGTA. Internal left primer: GATCATCGTTATTTTCGCCG. Internal right primer: TATAGAGCCGGGCTGAAATG. Internal WT amplicon: 1263 bp. Deletion size: 791 bp. Deletion left flank: AATGTATCCAAATGGAATTATTCGAATACT. Deletion right flank: CTGGTGGGTCTCGCAACGACATGAAGGAGG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00017982(hpo-18) | WBGene00017982(hpo-18) | WB-STRAIN:WBStrain00037472 | WormBase (WB) | WB | available | PMID:38946472 | WB-STRAIN:VC2645, CGC_VC2645 | 2026-08-15 09:33:28 | 1 | ||
|
VC2654 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00037477 | Caenorhabditis elegans | ubl-5(ok3389) I. | F46F11.4. External left primer: GGAGCGAAGAAAGAGGGAGT. External right primer: GTGCATGCGCCTTTAAGTTT. Internal left primer: GCAGAAATTAATGGGGTGGA. Internal right primer: GCGTCGAGTTGTGTGTTTTT. Internal WT amplicon: 1248 bp. Deletion size: 294 bp. Deletion left flank: TTTTTTTTTATTAAACAATAAAAAATGTAT. Deletion right flank: TCAAATTTTCAATTTGTTTCTAATATATAA.|"Supplementary_genotype ubl-5(ok3389) I"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006726(ubl-5) | WBGene00006726(ubl-5) | WB-STRAIN:WBStrain00037477 | WormBase (WB) | WB | available | PMID:37831769 | WB-STRAIN:VC2654, CGC_VC2654 | 2026-08-15 09:33:28 | 3 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
