Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=728191
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Extinct
Alternate IDs: 728191
Notes: To N in 1976 from Bazin at F?. In 1970 Bazin and Beckers started breeding LOU rat ancestors from various stocks kept at Universite Catholique de Louvain (probably of Wis- tar origin); from 28 lines bred in parallel, LOU/C was selected for high immunocytoma incidence and LOU/M for low immunocytoma incidence. (045)
Proper citation: RRID:RGD_728191 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=61115
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Extinct
Alternate IDs: 61115
Notes: To N 1972 from Silvers at F34. Silvers began brother-sister matings with selection for histocompatibility in 1958 from a brown mutation in a stock of wild rats maintained by King in a penbred colony.
Proper citation: RRID:RGD_61115 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=728194
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Extinct
Alternate IDs: 728194
Notes: To N 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with contin- ued selection for spontaneous hypertension.
Proper citation: RRID:RGD_728194 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=728198
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Extinct
Alternate IDs: 728198
Notes: To N in 1979 from Flow Laboratories. Closed colony since then. BHE was started in 1942 by the Agricultural Research Service. USDA from a cross between a black and white hooded strain from Pennsylvania State College and an albino Os- borne-Mendel (also called the Yale strain) strain from Columbia University.
Proper citation: RRID:RGD_728198 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=728187
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Extinct
Alternate IDs: 728187
Notes: Strain originated from Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Heston 1945 at F30, to National Institutes of Health 1950 at F41. Subsequent sublines from Dunning or NIH.
Proper citation: RRID:RGD_728187 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=631282
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Extinct
Alternate IDs: 631282
Notes: This speed congenic strain contains an F344 chromsome 10 segment transferred to a DA background.
Proper citation: RRID:RGD_631282 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=1566445
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Extinct
Alternate IDs: 1566445
Notes: This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background
Proper citation: RRID:RGD_1566445 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=737657
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Extinct
Alternate IDs: 737657
Notes: Originally derived by Dr. Hans J. Hedrich at Versuchstierzucht, Hannover, Germany by transgressing the MHC of DA/Han rats (AV1) into LEW/Han rats for 16 backcross generations. RT1av1 haplotype is a variant to the standard a- haplotype with the difference residing in the atypical MHC class I region.
Proper citation: RRID:RGD_737657 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=728196
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Extinct
Alternate IDs: 728196
Notes: Heterozygous Gunn rats were mated with RHA/N the heterzygous offsprings of this and each following generation was backcrossed with RHA/N to get these congenics.
Proper citation: RRID:RGD_728196 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131920
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 5131920
Notes: This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 24-bp frameshift deletion in exon 2.
Proper citation: RRID:RGD_5131920 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131921
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 5131921
Notes: This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 15-bp frameshift deletion in exon 2.
Proper citation: RRID:RGD_5131921 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139879
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 4139879
Notes: This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 6.
Proper citation: RRID:RGD_4139879 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5508371
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 5508371
Notes: This strain was produced by injecting ZFNs targeting the sequence GCCCCAGCCATGCTGTGCtatgtGACGAGGCCGGACGCGGTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 51-bp frameshift deletion in exon 1.
Proper citation: RRID:RGD_5508371 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5509997
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 5509997
Notes: This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS.BN-(D13Rat20-D13Got22)/Mcwi rat embryos. The resulting mutation is an 11-bp frameshift deletion in exon 6.
Proper citation: RRID:RGD_5509997 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5687974
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 5687974
Notes: This strain was produced by injecting ZFNs targeting the sequence CTGCTCTATGACCCTGACTatgtgAAGGTGGTTCTGGGAAGAT into SS-Chr 5BN/Mcwi strain rat embryos. The resulting mutation is a 2-bp framesnift deletion in exon 2.
Proper citation: RRID:RGD_5687974 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5687992
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 5687992
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5687992 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5687987
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 5687987
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5687987 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5688006
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 5688006
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5688006 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5688002
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 5688002
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5688002 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6893437
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 6893437
Notes: This strain was produced by injecting ZFNs targeting the sequence AGCTTCATACAGCGGCtccatgTTGCAGGGGATGGAAGTC into BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi rat embryos. The resulting mutation is a 13-bp deletion in exon 5.
Proper citation: RRID:RGD_6893437 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
