Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 2 showing 21 ~ 40 out of 1,466 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00033335

http://www.wormbase.org/db/get?name=WBStrain00033335

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005057(sra-31)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005057(sra-31), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: sra-31(ve506[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Alternate IDs: WB-STRAIN:RG3006, CGC_RG3006
Notes: Homozygous viable. Deletion of 1008 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gttttattttttaaatacCGTCATAAAAGC ; Right flanking sequence: CCAGGAATTTCCATtttagctgatatagat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1008 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: gttttattttttaaatacCGTCATAAAAGC ; Right flanking sequence: CCAGGAATTTCCATtttagctgatatagat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-31. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites."

Proper citation: RRID:WB-STRAIN:WBStrain00033335 Copy   


  • RRID:WB-STRAIN:WBStrain00033417

http://www.wormbase.org/db/get?name=WBStrain00033417

Source Database: WormBase (WB)
Affected Genes: WBGene00000446(ceh-23)|WBGene00003514(myo-2)|WBGene00003515(myo-3)|WBGene00006762(unc-25)|WBGene00006852(unc-129)
Genomic Alteration: WBGene00000446(ceh-23), WBGene00003514(myo-2), WBGene00003515(myo-3), WBGene00006762(unc-25), WBGene00006852(unc-129)
Availability: available
Source References: EMPTY
Synonyms: trIs10.
Alternate IDs: WB-STRAIN:RP1, CGC_RP1
Notes: Made_by: S Dixon / P Roy|"trIs10 [myo-3p::MB::YFP + myo-2p::YFP + ceh-23::HcRed + unc-25::DsRed + unc-129nsp::CFP]."

Proper citation: RRID:WB-STRAIN:WBStrain00033417 Copy   


  • RRID:WB-STRAIN:WBStrain00030592

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00030592

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00003983(pes-10)|WBGene00017698(F22B7.9)
Genomic Alteration: WBGene00003514(myo-2), WBGene00003983(pes-10), WBGene00017698(F22B7.9)
Availability: available
Source References: PMID:32434424, PMID:37067863
Synonyms: mIs10 V.
Alternate IDs: WB-STRAIN:PD4793, CGC_PD4793
Notes: mIs10 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] V. WT GFP phenotype, with expression in 4-cell embryos, pharyngeal muscle and gut. Strong GFP signal. Suppresses recombination between unc-60 and dpy-11. See WBG 15 #5 page 20.

Proper citation: RRID:WB-STRAIN:WBStrain00030592 Copy   


  • RRID:WB-STRAIN:WBStrain00030590

http://www.wormbase.org/db/get?name=WBStrain00030590

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00003983(pes-10)|WBGene00017698(F22B7.9)
Genomic Alteration: WBGene00003514(myo-2), WBGene00003983(pes-10), WBGene00017698(F22B7.9)
Availability: available
Source References: PMID:38564369
Synonyms: mIs12 II.
Alternate IDs: WB-STRAIN:PD4790, CGC_PD4790
Notes: mIs12 [myo-2p::GFP + pes-10p::GFP + F22B7.9::GFP] II. Hermaphrodites expressing compound GFP reporter (see PD4790). Strong pharyngeal muscle expression, easily scored by GFP dissecting scope. mIs12 is tightly linked to unc-4 II, and not to LG III or IV as previously reported. mIs12 homozygous males mate well (ME3). See WBG 15 #5 page 20. See CB5584.

Proper citation: RRID:WB-STRAIN:WBStrain00030590 Copy   


  • RRID:WB-STRAIN:WBStrain00029468

http://www.wormbase.org/db/get?name=WBStrain00029468

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001534(gcy-7)|WBGene00001578(ges-1)|WBGene00001867(him-8)|WBGene00003514(myo-2)|WBGene00003983(pes-10)|WBGene00006773(unc-37)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001534(gcy-7), WBGene00001578(ges-1), WBGene00001867(him-8), WBGene00003514(myo-2), WBGene00003983(pes-10), WBGene00006773(unc-37)
Availability: available
Source References: EMPTY
Synonyms: unc-37(ot59)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); him-8(e1489) IV; otIs3 V.
Alternate IDs: WB-STRAIN:OH4605, CGC_OH4605
Notes: Heterozygotes are WT and GFP+ in the pharynx. ot59 is homozygous inviable. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. otIs3[lin-15(+) + gcy-7::GFP]. otIs3 is expressed in ASEL in WT animals. In this ot59 strain, otIs3 is expressed in ASEL and ASER.

Proper citation: RRID:WB-STRAIN:WBStrain00029468 Copy   


  • RRID:WB-STRAIN:WBStrain00029503

http://www.wormbase.org/db/get?name=WBStrain00029503

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001534(gcy-7)|WBGene00001578(ges-1)|WBGene00003514(myo-2)|WBGene00003983(pes-10)|WBGene00006829(unc-101)|WBGene00009188(lsy-22)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001534(gcy-7), WBGene00001578(ges-1), WBGene00003514(myo-2), WBGene00003983(pes-10), WBGene00006829(unc-101), WBGene00009188(lsy-22)
Availability: available
Source References: PMID:20439776
Synonyms: lsy-22(ot114) unc-101(m1) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); otIs3 V.
Alternate IDs: WB-STRAIN:OH7116, CGC_OH7116
Notes: Made_by: Eileen Flowers|"otIs3 [gcy-7::GFP + lin-15(+)]. qIs48 [myo-2::GFP + pes-10::GFP + ges-1::GFP]. Homozygous hT2 animals are inviable. Heterozygotes are WT and GFP+. Homozygous lsy-22(ot114) unc-101(m1) animals are Unc and have a maternal effect embryonic lethal phenotype. Whole genome sequenced strain."

Proper citation: RRID:WB-STRAIN:WBStrain00029503 Copy   


  • RRID:WB-STRAIN:WBStrain00029941

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00029941

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)
Genomic Alteration: WBGene00003514(myo-2)
Availability: available
Source References: PMID:37957360
Synonyms: cuIs2 IV.
Alternate IDs: WB-STRAIN:OK39, CGC_OK39
Notes: cuIs2 [myo-2c:: GFP + rol-6(su1006)]. Rollers.|"Made_by: Christina Haun"|"Mutagen:Gamma rays"|"Supplementary_genotype Myo-2c"

Proper citation: RRID:WB-STRAIN:WBStrain00029941 Copy   


  • RRID:WB-STRAIN:WBStrain00027638

http://www.wormbase.org/db/get?name=WBStrain00027638

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)
Genomic Alteration: WBGene00003514(myo-2)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:MV1
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00027638 Copy   


  • RRID:WB-STRAIN:WBStrain00004991

http://www.wormbase.org/db/get?name=WBStrain00004991

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: F36D4.4(umn4[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
Alternate IDs: WB-STRAIN:CGC61, CGC_CGC61
Notes: Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATGTACTCCCCTATATCTTCCAAACATTC ; Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CATGTACTCCCCTATATCTTCCAAACATTC ; Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of F36D4.4. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: atgacaatgtctcaagggtccatgtactcccctatatcttccaaacattc Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCTCAATTTATTTGTCATTATTG"

Proper citation: RRID:WB-STRAIN:WBStrain00004991 Copy   


  • RRID:WB-STRAIN:WBStrain00004989

http://www.wormbase.org/db/get?name=WBStrain00004989

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00008737(gnrr-7)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00008737(gnrr-7)
Availability: available
Source References: EMPTY
Synonyms: gnrr-7(umn3[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X.
Alternate IDs: WB-STRAIN:CGC59, CGC_CGC59
Notes: Homozygous viable. Deletion of 1004 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttgttctggtttaaagccgcaaagtcttgg ; Right flanking sequence: agggtaccatcaagcaatggcattctggtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1004 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ttgttctggtttaaagccgcaaagtcttgg ; Right flanking sequence: agggtaccatcaagcaatggcattctggtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of gnrr-7. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ATATTTATTTAATATATATTTTGTTCTGGTTTAAAGCCGCAAAGTCTTGG Right flanking sequence: AGGGTACCATCAAGCAATGGCATTCTGGTTGCCCTTAAGCATAACAATTG"

Proper citation: RRID:WB-STRAIN:WBStrain00004989 Copy   


  • RRID:WB-STRAIN:WBStrain00004988

http://www.wormbase.org/db/get?name=WBStrain00004988

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: C54E10.3(umn2[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
Alternate IDs: WB-STRAIN:CGC58, CGC_CGC58
Notes: Homozygous viable. Deletion of 745 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tgtacccccgatgggattcgaacctgtggc ; Right flanking sequence: gggtatgcaaaatgaccgcgttttctgtga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 745 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtacccccgatgggattcgaacctgtggc ; Right flanking sequence: gggtatgcaaaatgaccgcgttttctgtga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of C54E10.3. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: tctccgcctaaaaaaatatatgtacccccgatgggattcgaacctgtggc Right flanking sequence: GGGTATGCAAAATGACCGCGTTTTCTGTGAATTCATCGTCATGCTTTATT"

Proper citation: RRID:WB-STRAIN:WBStrain00004988 Copy   


  • RRID:WB-STRAIN:WBStrain00005002

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005002

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00021328(npr-23)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00021328(npr-23)
Availability: available
Source References: EMPTY
Synonyms: npr-23(umn5[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I.
Alternate IDs: WB-STRAIN:CGC72, CGC_CGC72
Notes: Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of npr-23. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: cccctgcctctggctcccacaaggcgtcatctggagagaagaacgaagtg Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGCGTTGCTCGTATTGGTGCCGG"

Proper citation: RRID:WB-STRAIN:WBStrain00005002 Copy   


  • RRID:WB-STRAIN:WBStrain00005007

http://www.wormbase.org/db/get?name=WBStrain00005007

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: C04C3.6(umn8[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV.
Alternate IDs: WB-STRAIN:CGC78, CGC_CGC78
Notes: Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaatcaactatttttaatgaaaatttca ; Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: aaaaatcaactatttttaatgaaaatttca ; Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of C04C3.6. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ttgaaaatttgaaatttgaaaaaaatcaactatttttaatgaaaatttca Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGTTCATCGTGCTTCGAAAGTAC"

Proper citation: RRID:WB-STRAIN:WBStrain00005007 Copy   


  • RRID:WB-STRAIN:WBStrain00005026

http://www.wormbase.org/db/get?name=WBStrain00005026

Source Database: WormBase (WB)
Affected Genes: WBGene00003289(mir-61)|WBGene00003514(myo-2)
Genomic Alteration: WBGene00003289(mir-61), WBGene00003514(myo-2)
Availability: available
Source References: EMPTY
Synonyms: mir-61(umn15[lox2272 myo-2p::wrmScarlet + lox511I + Lox2272]) V.
Alternate IDs: WB-STRAIN:CGC103, CGC_CGC103
Notes: Made_by: Julie Knott & Marcus Vargas|"mir-61(umn15[lox2272 myo-2p::wrmScarlet + lox511I + Lox2272]) V. Derived by CRE-meditated excision of SEC in parental strain CGC102, leaving myo-2p::wrmScarlet."

Proper citation: RRID:WB-STRAIN:WBStrain00005026 Copy   


  • RRID:WB-STRAIN:WBStrain00005046

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005046

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004897(snb-1)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004897(snb-1)
Availability: unknown
Source References: PMID:21123567, PMID:39724103
Synonyms: [Psnb-1::TDP-43(A315T), Pmyo-2::dsRED]
Alternate IDs: WB-STRAIN:CK426
Notes: Psnb-1::TDP-43 (A315T)|"[2020-05-27T21:32:53.973Z WBPerson324] Ressurect Strain: WBPaper00037845, Genotype: [Psnb-1::TDP-43(A315T), Pmyo-2::dsRED]"|"[2020-05-27T21:32:53.973Z WBPerson324] Update Strain: WBPaper00037845, Genotype: [Psnb-1::TDP-43(A315T), Pmyo-2::dsRED]"

Proper citation: RRID:WB-STRAIN:WBStrain00005046 Copy   


  • RRID:WB-STRAIN:WBStrain00005043

http://www.wormbase.org/db/get?name=WBStrain00005043

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004897(snb-1)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004897(snb-1)
Availability: unknown
Source References: PMID:21123567, PMID:29409526
Synonyms: [Psnb-1::TDP-43(+), Pmyo-2::dsRED]
Alternate IDs: WB-STRAIN:CK410
Notes: Psnb-1::TDP-43 (WT)|"[2020-05-27T21:05:07.59Z WBPerson324] Adding data Strain: WBPaper00037845, Genotype: [Psnb-1::TDP-43(+), Pmyo-2::dsRED] Description: expresses pan-neuronal human wild-type TDP-43 cDNA (NM_007375) and a Pmyo-2::dsRED coinjection marker, at a lower level"

Proper citation: RRID:WB-STRAIN:WBStrain00005043 Copy   


  • RRID:WB-STRAIN:WBStrain00005044

http://www.wormbase.org/db/get?name=WBStrain00005044

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004897(snb-1)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004897(snb-1)
Availability: unknown
Source References: PMID:21123567, PMID:39724103
Synonyms: [Psnb-1::TDP-43(G290A), Pmyo-2::dsRED]
Alternate IDs: WB-STRAIN:CK422
Notes: Psnb-1::TDP-43 (G290A)|"[2020-05-27T21:29:50.154Z WBPerson324] Adding data Strain: WBPaper00037845, Genotype: [Psnb-1::TDP-43(G290A), Pmyo-2::dsRED]"

Proper citation: RRID:WB-STRAIN:WBStrain00005044 Copy   


  • RRID:WB-STRAIN:WBStrain00005042

http://www.wormbase.org/db/get?name=WBStrain00005042

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004897(snb-1)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004897(snb-1)
Availability: unknown
Source References: PMID:21123567
Synonyms: [Psnb-1::TDP-43(+), Pmyo-2::dsRED]
Alternate IDs: WB-STRAIN:CK405
Notes: Psnb-1::TDP-43 (WT)|"[2020-05-27T21:00:18.108Z WBPerson324] Adding data Strain: WBPaper00037845, Genotype: [Psnb-1::TDP-43(+), Pmyo-2::dsRED] Description: expresses pan-neuronal human wild-type TDP-43 cDNA (NM_007375) and a Pmyo-2::dsRED coinjection marker."

Proper citation: RRID:WB-STRAIN:WBStrain00005042 Copy   


  • RRID:WB-STRAIN:WBStrain00005589

http://www.wormbase.org/db/get?name=WBStrain00005589

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)
Genomic Alteration: WBGene00003514(myo-2)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:DA2038
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00005589 Copy   


  • RRID:WB-STRAIN:WBStrain00007980

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00007980

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00003514(myo-2), WBGene00006843(unc-119)
Availability: available
Source References: PMID:32088829, PMID:37080524, PMID:37838776, PMID:39149885, PMID:39329779
Synonyms: gnaIs2 [myo-2p::YFP + unc-119p::Abeta1-42]
Alternate IDs: WB-STRAIN:GRU102, CGC_GRU102
Notes: gnaIs2 [myo-2p::YFP + unc-119p::Abeta1-42]. Pan-neuronal amyloid beta1-42 expression. Impaired neuromuscular and sensorimotor behavior. See GRU101 for wild-type control strain. Reference: Fong S, et al. Sci Rep. 2016 Sep 22;6:33781. doi: 10.1038/srep33781.|"Supplementary_genotype gnaIs2 [myo-2p::YFP + unc-119p::Abeta1-42],"|[2020-10-08T19:09:27.569Z WBPerson324] Ressurect Strain: Genotype: gnaIs2 [myo-2p::YFP + unc-119p::humanAbeta1-42]|[2020-10-08T23:35:51.358Z WBPerson324] Ressurect Strain: Genotype: gnaIs2 [myo-2p::YFP + unc-119p::Abeta1-42]

Proper citation: RRID:WB-STRAIN:WBStrain00007980 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X