Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 19 showing 361 ~ 380 out of 62,713 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00037325

http://www.wormbase.org/db/get?name=WBStrain00037325

Source Database: WormBase (WB)
Affected Genes: WBGene00008205(sams-1)
Genomic Alteration: WBGene00008205(sams-1)
Availability: available
Source References: EMPTY
Synonyms: sams-1(ok2946) X.
Alternate IDs: WB-STRAIN:VC2428, CGC_VC2428
Notes: C49F5.1. External left primer: AGGACTTGCGAGAGTACGGA. External right primer: CTTGAGAGCTTTTGGCTGCT. Internal left primer: AGTGAATCTGTGTCCGAGGG. Internal right primer: GGGAACTCAGAGTGACCGAA. Internal WT amplicon: 1248 bp. Deletion size: 707 bp. Deletion left flank: TAGCTTGTTTCAATGTTTTTGTTCAGGATT. Deletion right flank: TCGGAACTTCCCCACTCACCGACGAAGAGC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037325 Copy   


  • RRID:WB-STRAIN:WBStrain00037331

http://www.wormbase.org/db/get?name=WBStrain00037331

Source Database: WormBase (WB)
Affected Genes: WBGene00003938(pax-2)
Genomic Alteration: WBGene00003938(pax-2)
Availability: available
Source References: EMPTY
Synonyms: pax-2(ok3078) IV.
Alternate IDs: WB-STRAIN:VC2438, CGC_VC2438
Notes: K06B9.5. External left primer: AGGCTAATGAAACGTGCCAA. External right primer: AATTTTCGAGTCGTTGGTCG. Internal left primer: ACAGAGAAATGGCGAGTTGC. Internal right primer: CACGTGGGTAATGTGGTACG. Internal WT amplicon: 1183 bp. Deletion size: 527 bp. Deletion left flank: AACTAAAAAGTGTACTTTATTGAGATTATA. Deletion right flank: GTGTTCTCCGACAAGTCCAGTAGGATAGAC. Insertion Sequence: GTGTACTTTATTGAGATTATA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037331 Copy   


  • RRID:WB-STRAIN:WBStrain00037334

http://www.wormbase.org/db/get?name=WBStrain00037334

Source Database: WormBase (WB)
Affected Genes: WBGene00000405(cdk-1)|WBGene00001072(dpy-10)
Genomic Alteration: WBGene00000405(cdk-1), WBGene00001072(dpy-10)
Availability: available
Source References: EMPTY
Synonyms: +/mT1 II; cdk-1(ok1881)/mT1 [dpy-10(e128)] III.
Alternate IDs: WB-STRAIN:VC2446, CGC_VC2446
Notes: Mutagen:UV/TMP|"T05G5.3. Homozygous sterile deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1881 homozygotes (sterile Unc). Pick WT and check for correct segregation of progeny to maintain. External left primer: CACTAAGCAATGGTCTCGCA. External right primer: CGACAACAATGGAAACATCG. Internal left primer: CGCTTACGCCTTTTCTATCG. Internal right primer: ACCATTCTCTCGTGAATCCG. Internal WT amplicon: 2136 bp. Deletion size: 1140 bp. Deletion left flank: AATCGGCGAAGGAACATACGGAGTCGTCTA. Deletion right flank: TCGTCTTCCGTGTATTGTTTAACTATCACC."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037334 Copy   


  • RRID:WB-STRAIN:WBStrain00037332

http://www.wormbase.org/db/get?name=WBStrain00037332

Source Database: WormBase (WB)
Affected Genes: WBGene00003527(nas-8)
Genomic Alteration: WBGene00003527(nas-8)
Availability: available
Source References: EMPTY
Synonyms: nas-8(ok3137) IV.
Alternate IDs: WB-STRAIN:VC2439, CGC_VC2439
Notes: C34D4.9. External left primer: ACCATTATCCCACAAATGCC. External right primer: TGGAAGCTTCACATCACTGC. Internal left primer: TACACGAAAATGGCCAAATG. Internal right primer: ATTGGTACATCAGATTCATTTTTAA. Internal WT amplicon: 1132 bp. Deletion size: 422 bp. Deletion left flank: CTGCGTTCGATTTGTTCCTAGAACCGCTGT. Deletion right flank: TTGTATTTGCACAGTATAGATTTGCAAATC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037332 Copy   


  • RRID:WB-STRAIN:WBStrain00037333

http://www.wormbase.org/db/get?name=WBStrain00037333

Source Database: WormBase (WB)
Affected Genes: WBGene00017803(F26A1.4)
Genomic Alteration: WBGene00017803(F26A1.4)
Availability: available
Source References: EMPTY
Synonyms: F26A1.4(gk1167) III.
Alternate IDs: WB-STRAIN:VC2441, CGC_VC2441
Notes: F26A1.4. External left primer: TTTAGGTCTGGCACTACCCG. External right primer: AAAACATTGACACACCTGCG. Internal left primer: AAAGCGGCAGCAGTTAAGAA. Internal right primer: CTACCGGTACTGCCATTCGT. Internal WT amplicon: 1327 bp. Deletion size: 174 bp. Deletion left flank: TTATGTTTATGTTTCAGTTCTGACACGCCA. Deletion right flank: TTAAAATATTTCAGATTGAATGTGGAGATG.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037333 Copy   


  • RRID:WB-STRAIN:WBStrain00037338

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00037338

Source Database: WormBase (WB)
Affected Genes: WBGene00001542(gcy-17)
Genomic Alteration: WBGene00001542(gcy-17)
Availability: available
Source References: EMPTY
Synonyms: gcy-17(gk1155) I.
Alternate IDs: WB-STRAIN:VC2450, CGC_VC2450
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"W03F11.2. External left primer: TCTAGGTCAAAAGCGGAGGA. External right primer: CTTTAACACGGTGAAGGGGA. Internal left primer: GGAAATGGAGCATCGAGGTA. Internal right primer: CATATGCAAGATGTTTGCCG. Internal WT amplicon: 1241 bp. Deletion size: 655 bp. Deletion left flank: GCATTGAGCTTCTGCTAATGACATCGGCCA. Deletion right flank: TAAATTTTGAGAGTAAAGTTCTTACATTTC."

Proper citation: RRID:WB-STRAIN:WBStrain00037338 Copy   


  • RRID:WB-STRAIN:WBStrain00037336

http://www.wormbase.org/db/get?name=WBStrain00037336

Source Database: WormBase (WB)
Affected Genes: WBGene00019205(kcc-2)
Genomic Alteration: WBGene00019205(kcc-2)
Availability: available
Source References: EMPTY
Synonyms: kcc-2(ok3074) IV/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC2448, CGC_VC2448
Notes: H16O14.1. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3074 homozygotes (sterile with no eggs, often with vulval blip). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGACGGCCAGATTCAGTAAA. External right primer: CGTAATGGCGGTTTTTGATT. Internal left primer: TTTGGTAACTTCTGGCCGTC. Internal right primer: GGGGCTTGTTTGAAAGAACA. Internal WT amplicon: 1227 bp. Deletion size: 582 bp. Deletion left flank: CAAACTAAGTATTTATTCTTTTAACATTTT. Deletion right flank: AGTAATTCTTTTTGGATGTTTCATGTCAAC. Insertion Sequence: TAAAAAGTATTTATTCTTTTAACATTCTTTTAACAC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037336 Copy   


  • RRID:WB-STRAIN:WBStrain00037308

http://www.wormbase.org/db/get?name=WBStrain00037308

Source Database: WormBase (WB)
Affected Genes: WBGene00012888(sas-6)
Genomic Alteration: WBGene00012888(sas-6)
Availability: available
Source References: EMPTY
Synonyms: sas-6(ok2554) IV/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC2399, CGC_VC2399
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y45F10D.9. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2554 homozygotes (sterile, no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTCATGAGAATCCCCGTTGT. External right primer: ACGGGATAAGTGGCTCACAC. Internal left primer: CGGAGGACTCCCAACTGATA. Internal right primer: TGAAAATGCGGGAAACTCTC. Internal WT amplicon: 2129 bp. Deletion size: 1435 bp. Deletion left flank: TATTGTCACGGAATGGGGTGCGCTGAAATT. Deletion right flank: CTGTTACTTTTGAAAATCGTTTGCTCCCTT."

Proper citation: RRID:WB-STRAIN:WBStrain00037308 Copy   


  • RRID:WB-STRAIN:WBStrain00037302

http://www.wormbase.org/db/get?name=WBStrain00037302

Source Database: WormBase (WB)
Affected Genes: WBGene00001545(gcy-20)|WBGene00005692(sru-29)
Genomic Alteration: WBGene00001545(gcy-20), WBGene00005692(sru-29)
Availability: available
Source References: EMPTY
Synonyms: gkDf17 II; gkDf18 C50C10.2(gk3035) gcy-20(gk1184) V.
Alternate IDs: WB-STRAIN:VC2391, CGC_VC2391
Notes: C40A11.7, C40A11.8, C40A11.1, F56E10.1, Y38C9A.1, C50C10.2, F21H7.9. The allele gk1184 was identified by PCR, validated by CGH, and can be detected using the following PCR primers. External left primer: AATCACTTTCGGTGCAGCTT. External right primer: GTATGCCCCACAGTTTTGCT. Internal left primer: AGTATCGCGGCATTGTTAGC. Internal right primer: TGCTCAAGCTTGGAGAGACA. Internal WT amplicon: 2419 bp. Deletion size: 2042 bp. Deletion left flank: ACCGCAATTAATTCCAATTCTAAGGTTTAT. Deletion right flank: ACTGGCGTCTTACAGTAAATTTTGTGTGAC. The allele gkDf17 was identified by CGH but not confirmed by PCR. Left flanking probe: ATTCCGCGATGTCTCCTTAAATCTTTTGGCAGAGGTTCTCGATTATCCAT. Right flanking probe: ATTGATCGAAAGTTACGAAGACGTGGACTAGTCCCAAAATTCCTAGTGAC. Left deleted probe: GAAAATAGATTTCTACCACTGAACTGTTTTTCTTAACAAACTCATCGAAT. Right deleted probe: CTGTTGAGAACATATCTAGTATTAAGGAAGGAGGGAACTATTCCACAGGC. The allele gkDf18 was identified by CGH but not confirmed by PCR. Left flanking probe: CGAATTTTCGAGGAAGATGAAGTTTATGCGGACGTCCAAAGTGTTGAAAA. Right flanking probe: GATTTCGCTGTGATAAGCGTCGAGGAGGCAATCGAAATGTGGAGCTTCTG. Left deleted probe: CCAAAGTGTTGAAAAACGGAAAATTCAGGATTTCGACGAGCGAATTGAGG. Right deleted probe: CAATTATGCAAATCTCGTCGATATTATACAAAATGATATAGATTTCGCTG. The allele gk3035 was identified by CGH but not confirmed by PCR. Left flanking probe: TGTTTCAGTATTGCCGTCTTATTATGTATAGATTTGCTATTCCATTTCTA. Right flanking probe: CATTTTCGAGTTCAATTTTCTGTGCAAACGCTGGAATGACAATATTCATG. Left deleted probe: TTTATCGTCCCATTAGCATTGTCACTTTTCAATGTTACTACAGTAGGATT. Right deleted probe: TTGTACGAAGGAGAGGAATATGCAAAGTTGAATGCTATTATTCATCTGTC.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037302 Copy   


  • RRID:WB-STRAIN:WBStrain00037387

http://www.wormbase.org/db/get?name=WBStrain00037387

Source Database: WormBase (WB)
Affected Genes: WBGene00022632(ZC581.2)
Genomic Alteration: WBGene00022632(ZC581.2)
Availability: available
Source References: EMPTY
Synonyms: ZC581.2(gk1146) I.
Alternate IDs: WB-STRAIN:VC2530, CGC_VC2530
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZC581.2. External left primer: TGTCTCCCAACTTCTCGTCC. External right primer: CAATGAAGAATGATCGGGCT. Internal left primer: GGAAACTTTGGAGCGTTCTG. Internal right primer: TTTACGACGTGTTCCATCCA. Internal WT amplicon: 1387 bp. Deletion size: 95 bp. Deletion left flank: TTGATCAATGTGAAATTTTGCGCAGAATCA. Deletion right flank: TTCCCGGAAGATGTTGTCATCAAAATTGAG."

Proper citation: RRID:WB-STRAIN:WBStrain00037387 Copy   


  • RRID:WB-STRAIN:WBStrain00037388

http://www.wormbase.org/db/get?name=WBStrain00037388

Source Database: WormBase (WB)
Affected Genes: WBGene00018569(F47F2.1)
Genomic Alteration: WBGene00018569(F47F2.1)
Availability: available
Source References: EMPTY
Synonyms: F47F2.1(gk1140) X.
Alternate IDs: WB-STRAIN:VC2531, CGC_VC2531
Notes: F47F2.1. Identified by PCR, validated by CGH. External left primer: TGAAAGTGCTCAACATTCGG. External right primer: CAAGGGGGAGCTATACACCA. Internal left primer: AGCATCACGGTGAGTGGTTA. Internal right primer: CATACATCCGATGCGTTGAG. Internal WT amplicon: 1402 bp. Deletion size: 548 bp. Deletion left flank: AGTAATTGAGAAAGATTTTGGTTGCAATTT. Deletion right flank: TGATGGTCGGAAAGCCCCCATTCCGTGGAA. Insertion Sequence: T.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037388 Copy   


  • RRID:WB-STRAIN:WBStrain00037305

http://www.wormbase.org/db/get?name=WBStrain00037305

Source Database: WormBase (WB)
Affected Genes: WBGene00004170(pqn-90)
Genomic Alteration: WBGene00004170(pqn-90)
Availability: available
Source References: EMPTY
Synonyms: pqn-90(gk1086) IV.
Alternate IDs: WB-STRAIN:VC2394, CGC_VC2394
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y73F8A.8. External left primer: ACAACCCGTGCAAGAAAAAC. External right primer: AAGTGGGACGGAACTGTTTG. Internal left primer: ACAATCGCGTCAGTAGGAGC. Internal right primer: CAGGGTTGTAGGACGTTGGT. Internal WT amplicon: 1894 bp. Deletion size: 519 bp. Deletion left flank: AACTGAAGGTTCTAGGATGACAGTCACAATTTGTGGAGCAACAACTGGAGATTGGCATG CTGATTGGCATTGCTGACATTGTGGAGCAGCTGGTTGCTGACATTGTGGAATACATTGT TGTTGGCACTGTTGAGTCTGTTGGCACGAAGTTTGACATTGTTGGCAAGCTGGTGCAGA TGGAAGTGTGCATTGTGGAGCACACTGTTGCTGGCAAACTGGAGCATACTGCTGGCAAG TATTCTGGCACTGCTGGCACTGTGGAGCTGATGGCTGTTGGCA. Deletion right flank: CACTTGGTAAGTTACTTGCTGAACTGGTTGGGCACATGAGCAGGATGTCTGGACTGGAG CAGTGTTCTGACACGAACAACTGTACTGTTGTGGTTGAGTTGCTTGTTGGCATGAACAA CTTGGTTGAACTTGTGAAGCACAACCACATGATTGACGTTTATCACGAATTGAA. Validation: No CGH probes for gk1086."|"Y73F8A.8. External left primer: ACAACCCGTGCAAGAAAAAC. External right primer: AAGTGGGACGGAACTGTTTG. Internal left primer: ACAATCGCGTCAGTAGGAGC. Internal right primer: CAGGGTTGTAGGACGTTGGT. Internal WT amplicon: 1894 bp. Deletion size: 519 bp. Deletion left flank: AACTGAAGGTTCTAGGATGACAGTCACAATTTGTGGAGCAACAACTGGAGATTGGCATGCTGATTGGCATTGCTGACATTGTGGAGCAGCTGGTTGCTGACATTGTGGAATACATTGTTGTTGGCACTGTTGAGTCTGTTGGCACGAAGTTTGACATTGTTGGCAAGCTGGTGCAGATGGAAGTGTGCATTGTGGAGCACACTGTTGCTGGCAAACTGGAGCATACTGCTGGCAAGTATTCTGGCACTGCTGGCACTGTGGAGCTGATGGCTGTTGGCA. Deletion right flank: CACTTGGTAAGTTACTTGCTGAACTGGTTGGGCACATGAGCAGGATGTCTGGACTGGAGCAGTGTTCTGACACGAACAACTGTACTGTTGTGGTTGAGTTGCTTGTTGGCATGAACAACTTGGTTGAACTTGTGAAGCACAACCACATGATTGACGTTTATCACGAATTGAA. Validation: No CGH probes for gk1086."

Proper citation: RRID:WB-STRAIN:WBStrain00037305 Copy   


  • RRID:WB-STRAIN:WBStrain00037306

http://www.wormbase.org/db/get?name=WBStrain00037306

Source Database: WormBase (WB)
Affected Genes: WBGene00003167(mec-3)
Genomic Alteration: WBGene00003167(mec-3)
Availability: available
Source References: PMID:37587694
Synonyms: mec-3(gk1126) IV.
Alternate IDs: WB-STRAIN:VC2396, CGC_VC2396
Notes: F01D4.6. Identified by PCR, validated by CGH. External left primer: CGCGTTGAAGTCAGTTGTGT. External right primer: GACTCCTGTTGGATTGGCAT. Internal left primer: CTGCCACATCAGTGTTGCTT. Internal right primer: CAAAGCCTCTCAGTGCGATT. Internal WT amplicon: 2450 bp. Deletion size: 774 bp. Deletion left flank: GAGCAAAGCGTAAAAAATGATTACATCTTT. Deletion right flank: TTTTACTTGACTCTCTGAAAGTCGAACAGA. Insertion Sequence: TTACTT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037306 Copy   


  • RRID:WB-STRAIN:WBStrain00037392

http://www.wormbase.org/db/get?name=WBStrain00037392

Source Database: WormBase (WB)
Affected Genes: WBGene00006814(unc-82)
Genomic Alteration: WBGene00006814(unc-82)
Availability: available
Source References: EMPTY
Synonyms: unc-82(gk1124) IV.
Alternate IDs: WB-STRAIN:VC2535, CGC_VC2535
Notes: B0496.3. Identified by PCR, validated by CGH. External left primer: GATGTTGTCGCATTGTGTCC. External right primer: AACTTGATGGATCTGGTGGC. Internal left primer: TGCGCTTCTAATCGTAAGGC. Internal right primer: GGTTCCTCGTCAGGATCAAA. Internal WT amplicon: 2549 bp. Deletion size: 595 bp. Deletion left flank: AGAAACTAGACATAAATCAAGGTATTACTT. Deletion right flank: ACTAAAAGTAAAGGTTACAATTCCAAATTA. Insertion Sequence: AAATAGACATAAATCAAGGTATT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037392 Copy   


  • RRID:WB-STRAIN:WBStrain00037394

http://www.wormbase.org/db/get?name=WBStrain00037394

Source Database: WormBase (WB)
Affected Genes: WBGene00001853(hil-2)
Genomic Alteration: WBGene00001853(hil-2)
Availability: available
Source References: EMPTY
Synonyms: hil-2(ok2548) IV/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC2537, CGC_VC2537
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y73B6BL.9. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2548 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TACAAAGGTGGGAGGTACGC. External right primer: GAGCATGATGTGACACCCAC. Internal left primer: GGGGCAAAACTATGAGAGCA. Internal right primer: TTTTGCGCTTTTTCAGTGTG. Internal WT amplicon: 2810 bp. Deletion size: approximately 1700 bp."

Proper citation: RRID:WB-STRAIN:WBStrain00037394 Copy   


  • RRID:WB-STRAIN:WBStrain00037318

http://www.wormbase.org/db/get?name=WBStrain00037318

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00022851(ZK1127.4)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00022851(ZK1127.4)
Availability: available
Source References: EMPTY
Synonyms: ZK1127.4(ok1940)/mIn1 [mIs14 dpy-10(e128)] II.
Alternate IDs: WB-STRAIN:VC2417, CGC_VC2417
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"ZK1127.4. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1940 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAAAAATGGATTGCCGAAGA. External right primer: GGGAAGTTCGTAATCGGTGA. Internal left primer: TTTCAGGCCAAATGTCCTTC. Internal right primer: CTGACAGCTCACACCACGAT. Internal WT amplicon: 2174 bp. Deletion size: 1250 bp. Deletion left flank: TGGAAGCATTCGTGAAGATTTGTCCGGCTT. Deletion right flank: CCTTCACGGTTGGCCCTGCTTTGAAGCTTG. Insertion Sequence: AGA."

Proper citation: RRID:WB-STRAIN:WBStrain00037318 Copy   


  • RRID:WB-STRAIN:WBStrain00037312

http://www.wormbase.org/db/get?name=WBStrain00037312

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00004858(sma-4)
Genomic Alteration: WBGene00000254(bli-4), WBGene00004858(sma-4)
Availability: available
Source References: EMPTY
Synonyms: sma-4(ok3140) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2410, CGC_VC2410
Notes: R12B2.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3140 homozygotes (late larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GACGGAAAGGTGTTCCACAT. External right primer: GGTCCGTGCAGAAAATCAGT. Internal left primer: CGCAAGAATATGGAGATGGC. Internal right primer: TGCTCGTACTGCTTCATTGC. Internal WT amplicon: 1288 bp. Deletion size: 718 bp. Deletion left flank: AGAGGTGGCTGCTCTCTCTCTCTGACTTTT. Deletion right flank: TTCGTCCGATCCGGGTACCTAGACTACACT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037312 Copy   


  • RRID:WB-STRAIN:WBStrain00037313

http://www.wormbase.org/db/get?name=WBStrain00037313

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00021660(nol-14)
Genomic Alteration: WBGene00000254(bli-4), WBGene00021660(nol-14)
Availability: available
Source References: EMPTY
Synonyms: Y48G1A.4(ok3096) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2411, CGC_VC2411
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y48G1A.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3096 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TAAACTCGCAAAAATTCGCA. External right primer: TCAAATTGCACAAATTCCGA. Internal left primer: TGAAGTGTTTGCGTACAGCG. Internal right primer: TTTTTGGGTTTTAGGTTTTCCA. Internal WT amplicon: 1221 bp. Deletion size: 520 bp. Deletion left flank: TGCGCACGACTTGACGCGCAAACTTCCCAA. Deletion right flank: GGAAAAGCGCTCTCGGACATTGAAAAATAC. Insertion Sequence: CAAA."

Proper citation: RRID:WB-STRAIN:WBStrain00037313 Copy   


  • RRID:WB-STRAIN:WBStrain00037398

http://www.wormbase.org/db/get?name=WBStrain00037398

Source Database: WormBase (WB)
Affected Genes: WBGene00044109(K02E11.10)
Genomic Alteration: WBGene00044109(K02E11.10)
Availability: available
Source References: EMPTY
Synonyms: K02E11.10(ok3266) V/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC2541, CGC_VC2541
Notes: K02E11.10. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3266 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGCAACTTGTCCTTGTTGGG. External right primer: GGAGTGTGCAGCAAATTTCA. Internal left primer: CTTCGAAGCCTCCTTGAGTA. Internal right primer: GCGTCTTGAGGCCATAGTTC. Internal WT amplicon: 1208 bp. Deletion size: 582 bp. Deletion left flank: CCTGAGCAGGCCCTTGCTGATATCCGGCTC. Deletion right flank: GGCAGGCTAAGATCACAACGGATTTCATCT. Insertion Sequence: TTCCCTGAACTCCTTGAGCAGATCCCT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037398 Copy   


  • RRID:WB-STRAIN:WBStrain00037317

http://www.wormbase.org/db/get?name=WBStrain00037317

Source Database: WormBase (WB)
Affected Genes: WBGene00009559(mtx-1)
Genomic Alteration: WBGene00009559(mtx-1)
Availability: available
Source References: EMPTY
Synonyms: mtx-1(ok3155) I.
Alternate IDs: WB-STRAIN:VC2415, CGC_VC2415
Notes: F39B2.11. External left primer: GATTTTGTCGTCTCGTGGGT. External right primer: CAGGATAGCAATTGGGGAGA. Internal left primer: AGTAGGTAGGGGGCAAGCAA. Internal right primer: CTTTGTTCGAAATTTTCCGC. Internal WT amplicon: 1278 bp. Deletion size: 371 bp. Deletion left flank: TCTTACCACTGCTGGATACAAATTGTGATG. Deletion right flank: CTTGAAATTCCAAATTCGGAAAAAAATCAA.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037317 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X