Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
VC2389 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037301 | Caenorhabditis elegans | ubc-16(ok3176) I. | Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y54E5B.4. External left primer: AAGTTGTCGGAATTGGTTGG. External right primer: TTGCGATTCGAAGAGAGCTT. Internal left primer: CATTGTTCAATATGCACCCAA. Internal right primer: TGGCCACAAAGAAGAAAAGG. Internal WT amplicon: 1138 bp. Deletion size: 684 bp. Deletion left flank: AATTGATGACGCTATTTATGTGAGAACGTG. Deletion right flank: AACGGCACACTGCCGGAATTAAAATTTCCG. Insertion Sequence: TGAG." | WBGene00006711(ubc-16) | WBGene00006711(ubc-16) | WB-STRAIN:WBStrain00037301 | WormBase (WB) | WB | available | WB-STRAIN:VC2389, CGC_VC2389 | 2026-08-15 09:33:25 | 0 | |||
|
VC2338 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037266 | Caenorhabditis elegans | pgp-3(ok3091) X. | Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK455.7. External left primer: GCGAATGCTCTTATGGAAGG. External right primer: TTGCAAATGAACTCGTGAGC. Internal left primer: CGTTATGCGAACGACGACTA. Internal right primer: ATTCGGATGTTTTCAGCGAC. Internal WT amplicon: 1151 bp. Deletion size: 609 bp. Deletion left flank: TTCGATGTATCTATCAGCGAAGCATCTGAA. Deletion right flank: GCTTGTTGGGCATTCTGGATGTGGAAAATC." | WBGene00003997(pgp-3) | WBGene00003997(pgp-3) | WB-STRAIN:WBStrain00037266 | WormBase (WB) | WB | available | WB-STRAIN:VC2338, CGC_VC2338 | 2026-08-15 09:33:25 | 0 | |||
|
VC2340 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037267 | Caenorhabditis elegans | W02D9.3(gk1128) I; rbf-1(gk3217) III; srh-145(gk3218) V. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain is homozygous for a deletion (gk1128) in W02D9.3, detectable by PCR using the following primers. External left primer: ACGGATTTTGCCACTTTGTC. External right primer: CATCACATTTCTCGTGGTGG. Internal left primer: TTGGAGAGGTGTGAACGTAGAA. Internal right primer: TTTCTAGGCCGTACGTTGCT. Internal WT amplicon: 1621 bp. Deletion size: 1315 bp. Note: internal left primer binding site deleted in gk1128; major deletion product from nested PCR runs at about 650 bp. Deletion left flank: GCAGAAAAAATTTTGGAATTTGAGCTACAT. Deletion right flank: CATTTTCTTGCAGAAAAACGTGCAAAATTC. Validation: gk1128 passed by CGH. Other deletions (gk3217, gk3218) identified by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00004316(rbf-1)|WBGene00005361(srh-145)|WBGene00012209(hmg-20) | WBGene00004316(rbf-1), WBGene00005361(srh-145), WBGene00012209(hmg-20) | WB-STRAIN:WBStrain00037267 | WormBase (WB) | WB | available | WB-STRAIN:VC2340, CGC_VC2340 | 2026-08-15 09:33:24 | 0 | |||
|
VC2388 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037300 | Caenorhabditis elegans | zeel-1(ok2484) I. | This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y39G10AR.5. External left primer: GCTGAATTCTCCGGCTTAAA. External right primer: TAGCCAGAGCCCGTGTAAGT. Internal left primer: CATCAAGATAAACCGGCAAA. Internal right primer: CACGTTTCGAGGTGTCGTTA. Internal WT amplicon: 1126 bp. Deletion size: 767 bp. Deletion left flank: AAGAAGATTTCTCAGAACTCTGCGATTCCT. Deletion right flank: AGAAAGGTTTATTTTTTGAAAAGTTAACGA." | WBGene00021463(zeel-1) | WBGene00021463(zeel-1) | WB-STRAIN:WBStrain00037300 | WormBase (WB) | WB | available | WB-STRAIN:VC2388, CGC_VC2388 | 2026-08-15 09:33:25 | 0 | |||
|
VC2344 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037271 | Caenorhabditis elegans | C34D1.1(gk1133) B0462.4(gk3031) V. | C34D1.1, B0462.4. The allele gk1133 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: AGGCTGACGGCTTCTAATGA. External right primer: GCGGTAGTGCATTCCAATTT. Internal left primer: GATGGCTGGAATGTTGGAGT. Internal right primer: GAGACATGCACACTAGCCGA. Internal WT amplicon: 1370 bp. Deletion size: 337 bp. Deletion left flank: TTTTTTTCAGATATTTAGGTTAGTCCACTT. Deletion right flank: GGGCACGCCCACTTTATACTATTTTGATGT. Insertion Sequence: TAT. The allele gk3031 was identified by CGH and not confirmed by PCR. Left flanking probe: TTATAAACAGAGACAAATTTAGACCAAAACTCTGTAGGAAAGTGAGTTTT. Right flanking probe: ACAGGAATATGAATTGAGTGATTGCTTGTGGTAGACTCTGTAGATGGTCT. Left deleted probe: AAGTGAGTTTTTCCGTGTGTTCTGTGGGATCAGGTGCTCCAAATCTTCCA. Right deleted probe: GCGCCAATGCTAATATTATACTTATATAAAAGCACTTAACAAGCTGAGCT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00007183(xxxp-1)|WBGene00007929(dmd-10) | WBGene00007183(xxxp-1), WBGene00007929(dmd-10) | WB-STRAIN:WBStrain00037271 | WormBase (WB) | WB | available | WB-STRAIN:VC2344, CGC_VC2344 | 2026-08-15 09:33:24 | 0 | |||
|
VC2345 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037272 | Caenorhabditis elegans | clec-106&Y18D10A.23(ok3090) I. | Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y18D10A.12, Y18D10A.23. External left primer: ACCACGACTGGGAAGTTCAG. External right primer: GCCTAACATCTGCCTTCTCG. Internal left primer: ACTGGATTCTAGGCCCACG. Internal right primer: GTTGCTCCATGCTACGTGAA. Internal WT amplicon: 1318 bp. Deletion size: 724 bp. Deletion left flank: CCTCCGTTTTGGTTTATGATATCGCGGAAG. Deletion right flank: TGCTCTTGAACCCGTCTCTGAACCAATTCA." | WBGene00012482(clec-106)|WBGene00012487(Y18D10A.23) | WBGene00012482(clec-106), WBGene00012487(Y18D10A.23) | WB-STRAIN:WBStrain00037272 | WormBase (WB) | WB | available | WB-STRAIN:VC2345, CGC_VC2345 | 2026-08-15 09:33:25 | 0 | |||
|
VC2343 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037270 | Caenorhabditis elegans | C47E8.6(gk1232) V. | C47E8.6. Identified by PCR, validated by CGH. External left primer: CCGTTACCATGCCAACTCTT. External right primer: TGATTTTGGCCGAGTAGGAC. Internal left primer: CCGTCACCTCTTAACGGAAA. Internal right primer: CGAACCAACCAGAATCTTCG. Internal WT amplicon: 1333 bp. Deletion size: 884 bp. Deletion left flank: TTTTGTTTCAGTTTTCATCGTAATTTTTTT. Deletion right flank: TTTCTTGCAGGTAGGAACTCTGAATATTCG.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00008144(gasr-8) | WBGene00008144(gasr-8) | WB-STRAIN:WBStrain00037270 | WormBase (WB) | WB | available | PMID:38302462 | WB-STRAIN:VC2343, CGC_VC2343 | 2026-08-15 09:33:24 | 0 | ||
|
VC2348 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037275 | Caenorhabditis elegans | T05C12.1(ok3101) II. | Made_by: Vancouver KO Group|"T05C12.1. External left primer: TTCCCGAGTATAGTCCCGTG. External right primer: CATGTGGATTGATTGTCCCA. Internal left primer: CAAGCAAAACGGTCATCAGA. Internal right primer: TGCTCATCTTGTTTCTTTCATTTT. Internal WT amplicon: 1144 bp. Deletion size: 531 bp. Deletion left flank: GATGCAAATGCTTGGAAAGAATATTGGAGA. Deletion right flank: TTCGTCCAGCCAACACTCCGGATTATACCA. Insertion Sequence: GAAATAGGAAAGAATATT."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00011466(T05C12.1) | WBGene00011466(T05C12.1) | WB-STRAIN:WBStrain00037275 | WormBase (WB) | WB | available | WB-STRAIN:VC2348, CGC_VC2348 | 2026-08-15 09:33:25 | 0 | |||
|
VC2349 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037276 | Caenorhabditis elegans | cpg-7(ok3141) II. | K09E4.6. External left primer: GAAAAATCTACACCGGCCAA. External right primer: CACCCTGCCTTCTTCACATT. Internal left primer: ATCGGGAGGACTCGAAAAGT. Internal right primer: CAGCTTTTGTCTCAGGCGAT. Internal WT amplicon: 1242 bp. Deletion size: 383 bp. Deletion left flank: AGATGATTCAAGGGTTGCATCACCGGATCC. Deletion right flank: ATATAGGCATATAGGCATATAGGCATATAGGCT.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00010723(cpg-7) | WBGene00010723(cpg-7) | WB-STRAIN:WBStrain00037276 | WormBase (WB) | WB | available | WB-STRAIN:VC2349, CGC_VC2349 | 2026-08-15 09:33:25 | 0 | |||
|
VC2346 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037273 | Caenorhabditis elegans | hsp-12.3(ok3095) IV. | F38E11.1. External left primer: TAAATCGGCAGAAAACGACC. External right primer: TGTTGCTCTCGAATCGTCAC. Internal left primer: AAAATTGTGGCCACCAAAAA. Internal right primer: ATTTCGTTGCTCATTGGTCC. Internal WT amplicon: 1297 bp. Deletion size: 533 bp. Deletion left flank: TGTTCACCATAAGAAACGAGGCGTCTCCTC. Deletion right flank: AAGGAATTCTCCAATGTTCTTCACATCAAT.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00002012(hsp-12.3) | WBGene00002012(hsp-12.3) | WB-STRAIN:WBStrain00037273 | WormBase (WB) | WB | available | WB-STRAIN:VC2346, CGC_VC2346 | 2026-08-15 09:33:24 | 0 | |||
|
VC2352 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037278 | Caenorhabditis elegans | R07C12.1(ok3048) IV/nT1 [qIs51] (IV;V). | R07C12.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3048 homozygotes (mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GATTTGGAGGCCAGTGTTGT. External right primer: GCCCTGAAACCGAAGTGTAA. Internal left primer: GCTCTGTTTGTAGGCTTGGG. Internal right primer: CAGCATATGGTGGCCAGTAG. Internal WT amplicon: 1301 bp. Deletion size: 537 bp. Deletion left flank: AATTGGTAGTGACTCGTTGAAAATTGTTGA. Deletion right flank: TGGTATACGTTTCTTTAAATTTTTTTTAAT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00019931(R07C12.1) | WBGene00019931(R07C12.1) | WB-STRAIN:WBStrain00037278 | WormBase (WB) | WB | available | WB-STRAIN:VC2352, CGC_VC2352 | 2026-08-15 09:33:25 | 0 | |||
|
VC2358 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037282 | Caenorhabditis elegans | sptl-2(ok2753) V. | F43H9.2. External left primer: TGAATACCCGGGAACTCGTA. External right primer: GAATAGCCAACGGATGGAGA. Internal left primer: CGTTGGATCCTATAATTATCTTGG. Internal right primer: GGCCGAAATACAGAATCGAA. Internal WT amplicon: 1128 bp. Deletion size: 572 bp. Deletion left flank: GTGCAGAACAATCAGCTTCCAGTATTGATA. Deletion right flank: CTGGAAAGGGAGTCGTTGAGTATTGGGGCT.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00018398(sptl-2) | WBGene00018398(sptl-2) | WB-STRAIN:WBStrain00037282 | WormBase (WB) | WB | available | WB-STRAIN:VC2358, CGC_VC2358 | 2026-08-15 09:33:25 | 0 | |||
|
VC2355 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037280 | Caenorhabditis elegans | apr-1(ok2970) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | K04G2.8. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2970 homozygotes (sterile with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGATTTGTGATGGCACAGT. External right primer: GCAGCACCAGAAGTTGATGA. Internal left primer: ATGGTAACGATTTTCCAGCG. Internal right primer: TGGTTCTTCAGCAGTTAATCCA. Internal WT amplicon: 1205 bp. Deletion size: 665 bp. Deletion left flank: TCATCAATTGACGTCTCAACAGCAGAACAC. Deletion right flank: GCTCAGACTGGTCTCCACAACAACAATTAC. Insertion Sequence: AGGACACCCAGCGATCATAACGGCATTGATGTGGCAAGAA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000156(apr-1)|WBGene00000254(bli-4) | WBGene00000156(apr-1), WBGene00000254(bli-4) | WB-STRAIN:WBStrain00037280 | WormBase (WB) | WB | available | WB-STRAIN:VC2355, CGC_VC2355 | 2026-08-15 09:33:25 | 0 | |||
|
VC2365 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037287 | Caenorhabditis elegans | F11E6.8(gk1178) IV. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain is homozygous for a deletion (gk1178) in F11E6.8, detectable by PCR using the following primers. External left primer: ACATATTCGACAAGGCACCC. External right primer: CACCCTTCGAGTCTACCCAG. Internal left primer: GCGAGTGAAAGGATCTGGAG. Internal right primer: TGGTGAGGGAATTGGAAAGA. Internal WT amplicon: 2406 bp. Deletion size: 1746 bp. Deletion left flank: ATTTTCCCATTTAGGTATACAAAACTTACA. Deletion right flank: GAGGCAAACTTCTCACTTCTTGAAACATTT. Validation: gk1178 passed by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00008711(F11E6.8) | WBGene00008711(F11E6.8) | WB-STRAIN:WBStrain00037287 | WormBase (WB) | WB | available | WB-STRAIN:VC2365, CGC_VC2365 | 2026-08-15 09:33:25 | 0 | |||
|
VC2360 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00037284 | Caenorhabditis elegans | ucr-2.3(ok3073) III. | Made_by: Vancouver KO Group|"T24C4.1. External left primer: CGTGCTGGTTCTCGTTATGA. External right primer: CATATGCAGAGATGGCGAGA. Internal left primer: TCACTCAGCCTGGACTTGTG. Internal right primer: TTCTGGACCGTTGTAGAGGG. Internal WT amplicon: 1135 bp. Deletion size: 415 bp. Deletion left flank: GAATTGTGTTTGAGGATATTCATCGCGCTG. Deletion right flank: CTTCTCCACTGAAATTTGCATCACTTCCAG. Insertion Sequence: TTCA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00020757(ucr-2.3) | WBGene00020757(ucr-2.3) | WB-STRAIN:WBStrain00037284 | WormBase (WB) | WB | available | WB-STRAIN:VC2360, CGC_VC2360 | 2026-08-15 09:33:25 | 1 | |||
|
VC2310 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037246 | Caenorhabditis elegans | Y97E10AR.2(ok3098) V. | Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y97E10AR.2. External left primer: TTGCCGTTCACAGTATCCAA. External right primer: ACGTCGAACTGATCCCCATA. Internal left primer: GAAACTGGTGGAAACGCTGT. Internal right primer: GAACGCTTACGAATAGAAGAGCA. Internal WT amplicon: 1332 bp. Deletion size: 716 bp. Deletion left flank: CATCCGCACACTACAGGACCGGGTTTTGGA. Deletion right flank: ATCATTTCCATCAAACCCAGAATATATTTT." | WBGene00022397(Y97E10AR.2) | WBGene00022397(Y97E10AR.2) | WB-STRAIN:WBStrain00037246 | WormBase (WB) | WB | available | WB-STRAIN:VC2310, CGC_VC2310 | 2026-08-15 09:33:24 | 0 | |||
|
VC2308 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037244 | Caenorhabditis elegans | stc-1(ok2829)/mIn1 [mIs14 dpy-10(e128)] II. | F54C9.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2829 homozygotes (probable embryonic arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAACCGCCAACGAGTACAAT. External right primer: CAACGGGATCATTGCTAGGT. Internal left primer: GCTAAAGCTGCCGTAATTGG. Internal right primer: TGGATTACCTCCACCACCTC. Internal WT amplicon: 1183 bp. Deletion size: 642 bp. Deletion left flank: TGCTTGAGTTACAAAAACTCCTCCTTGAAG. Deletion right flank: TCATTAAAACTTACAAGAAAGCAACGACAC. Insertion Sequence: TTAAAAC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001072(dpy-10)|WBGene00006059(stc-1) | WBGene00001072(dpy-10), WBGene00006059(stc-1) | WB-STRAIN:WBStrain00037244 | WormBase (WB) | WB | available | WB-STRAIN:VC2308, CGC_VC2308 | 2026-08-15 09:33:24 | 0 | |||
|
VC2309 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037245 | Caenorhabditis elegans | ZK669.4(ok3001) II. | This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"ZK669.4. Strain might be sensitive to hypochlorite; no survivors after mutliple attempts to clean by hypochlorite treatment. External left primer: TAGAGTGTTGAAAACGGGGG. External right primer: CCACACCAGCAGTTCGTAGA. Internal left primer: CATCAAGGGATAATTGGGCA. Internal right primer: GGAACTGGAAAAGACGGAAG. Internal WT amplicon: 1181 bp. Deletion size: 401 bp. Deletion left flank: TGTCATGTTTATCGAATCGTGGGAGTTTTT. Deletion right flank: CATTTTCCATTTTCTCATCAGTTGTAGAAT. Insertion Sequence: T." | WBGene00014054(dbt-1) | WBGene00014054(dbt-1) | WB-STRAIN:WBStrain00037245 | WormBase (WB) | WB | available | WB-STRAIN:VC2309, CGC_VC2309 | 2026-08-15 09:33:25 | 0 | |||
|
VC2317 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00037250 | Caenorhabditis elegans | nhr-235(gk1085) II. | Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y38E10A.19. External left primer: TTTTTCATTTTGTGTGGCGA. External right primer: AATTCTGTGGAACTCGGTGG. Internal left primer: TGCTTGGTAGCTTTGCTTCA. Internal right primer: GAGTCGTGGAGTCTTGGCAT. Internal WT amplicon: 1867 bp. Deletion size: 935 bp. Deletion left flank: ACTCAAAGCTTACGTTGGAAATTATGTCGG. Deletion right flank: CCGAAAATTTTCAAAAAATTTTAGGATCTA. Insertion Sequence: AAATTTTCCGAAAATTT." | WBGene00012597(nhr-235) | WBGene00012597(nhr-235) | WB-STRAIN:WBStrain00037250 | WormBase (WB) | WB | available | WB-STRAIN:VC2317, CGC_VC2317 | 2026-08-15 09:33:24 | 1 | |||
|
VC2323 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037254 | Caenorhabditis elegans | dct-13(gk992) IV. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y116A8C.17. External left primer: AGCGAGCATTGCAAAAAGAT. External right primer: TATGAATGTCCGTGCTCTGC. Internal left primer: AAGAGCTGAGCAATGCCAAT. Internal right primer: ACAGCGTTTGTTCCGTATCC. Internal WT amplicon: 785 bp. Deletion size: 94 bp. Deletion left flank: AATTGACACCTGGCTCCGTACTTGCAATAT. Deletion right flank: ATTTGCATGCTTCACCGTAAATGCATGTTT." | WBGene00013794(dct-13) | WBGene00013794(dct-13) | WB-STRAIN:WBStrain00037254 | WormBase (WB) | WB | available | WB-STRAIN:VC2323, CGC_VC2323 | 2026-08-15 09:33:25 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
