Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00037301
Source Database: WormBase (WB)
Affected Genes: WBGene00006711(ubc-16)
Genomic Alteration: WBGene00006711(ubc-16)
Availability: available
Source References: EMPTY
Synonyms: ubc-16(ok3176) I.
Alternate IDs: WB-STRAIN:VC2389, CGC_VC2389
Notes: Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y54E5B.4. External left primer: AAGTTGTCGGAATTGGTTGG. External right primer: TTGCGATTCGAAGAGAGCTT. Internal left primer: CATTGTTCAATATGCACCCAA. Internal right primer: TGGCCACAAAGAAGAAAAGG. Internal WT amplicon: 1138 bp. Deletion size: 684 bp. Deletion left flank: AATTGATGACGCTATTTATGTGAGAACGTG. Deletion right flank: AACGGCACACTGCCGGAATTAAAATTTCCG. Insertion Sequence: TGAG."
Proper citation: RRID:WB-STRAIN:WBStrain00037301 Copy
http://www.wormbase.org/db/get?name=WBStrain00037266
Source Database: WormBase (WB)
Affected Genes: WBGene00003997(pgp-3)
Genomic Alteration: WBGene00003997(pgp-3)
Availability: available
Source References: EMPTY
Synonyms: pgp-3(ok3091) X.
Alternate IDs: WB-STRAIN:VC2338, CGC_VC2338
Notes: Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK455.7. External left primer: GCGAATGCTCTTATGGAAGG. External right primer: TTGCAAATGAACTCGTGAGC. Internal left primer: CGTTATGCGAACGACGACTA. Internal right primer: ATTCGGATGTTTTCAGCGAC. Internal WT amplicon: 1151 bp. Deletion size: 609 bp. Deletion left flank: TTCGATGTATCTATCAGCGAAGCATCTGAA. Deletion right flank: GCTTGTTGGGCATTCTGGATGTGGAAAATC."
Proper citation: RRID:WB-STRAIN:WBStrain00037266 Copy
http://www.wormbase.org/db/get?name=WBStrain00037267
Source Database: WormBase (WB)
Affected Genes: WBGene00004316(rbf-1)|WBGene00005361(srh-145)|WBGene00012209(hmg-20)
Genomic Alteration: WBGene00004316(rbf-1), WBGene00005361(srh-145), WBGene00012209(hmg-20)
Availability: available
Source References: EMPTY
Synonyms: W02D9.3(gk1128) I; rbf-1(gk3217) III; srh-145(gk3218) V.
Alternate IDs: WB-STRAIN:VC2340, CGC_VC2340
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain is homozygous for a deletion (gk1128) in W02D9.3, detectable by PCR using the following primers. External left primer: ACGGATTTTGCCACTTTGTC. External right primer: CATCACATTTCTCGTGGTGG. Internal left primer: TTGGAGAGGTGTGAACGTAGAA. Internal right primer: TTTCTAGGCCGTACGTTGCT. Internal WT amplicon: 1621 bp. Deletion size: 1315 bp. Note: internal left primer binding site deleted in gk1128; major deletion product from nested PCR runs at about 650 bp. Deletion left flank: GCAGAAAAAATTTTGGAATTTGAGCTACAT. Deletion right flank: CATTTTCTTGCAGAAAAACGTGCAAAATTC. Validation: gk1128 passed by CGH. Other deletions (gk3217, gk3218) identified by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037267 Copy
http://www.wormbase.org/db/get?name=WBStrain00037300
Source Database: WormBase (WB)
Affected Genes: WBGene00021463(zeel-1)
Genomic Alteration: WBGene00021463(zeel-1)
Availability: available
Source References: EMPTY
Synonyms: zeel-1(ok2484) I.
Alternate IDs: WB-STRAIN:VC2388, CGC_VC2388
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y39G10AR.5. External left primer: GCTGAATTCTCCGGCTTAAA. External right primer: TAGCCAGAGCCCGTGTAAGT. Internal left primer: CATCAAGATAAACCGGCAAA. Internal right primer: CACGTTTCGAGGTGTCGTTA. Internal WT amplicon: 1126 bp. Deletion size: 767 bp. Deletion left flank: AAGAAGATTTCTCAGAACTCTGCGATTCCT. Deletion right flank: AGAAAGGTTTATTTTTTGAAAAGTTAACGA."
Proper citation: RRID:WB-STRAIN:WBStrain00037300 Copy
http://www.wormbase.org/db/get?name=WBStrain00037271
Source Database: WormBase (WB)
Affected Genes: WBGene00007183(xxxp-1)|WBGene00007929(dmd-10)
Genomic Alteration: WBGene00007183(xxxp-1), WBGene00007929(dmd-10)
Availability: available
Source References: EMPTY
Synonyms: C34D1.1(gk1133) B0462.4(gk3031) V.
Alternate IDs: WB-STRAIN:VC2344, CGC_VC2344
Notes: C34D1.1, B0462.4. The allele gk1133 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: AGGCTGACGGCTTCTAATGA. External right primer: GCGGTAGTGCATTCCAATTT. Internal left primer: GATGGCTGGAATGTTGGAGT. Internal right primer: GAGACATGCACACTAGCCGA. Internal WT amplicon: 1370 bp. Deletion size: 337 bp. Deletion left flank: TTTTTTTCAGATATTTAGGTTAGTCCACTT. Deletion right flank: GGGCACGCCCACTTTATACTATTTTGATGT. Insertion Sequence: TAT. The allele gk3031 was identified by CGH and not confirmed by PCR. Left flanking probe: TTATAAACAGAGACAAATTTAGACCAAAACTCTGTAGGAAAGTGAGTTTT. Right flanking probe: ACAGGAATATGAATTGAGTGATTGCTTGTGGTAGACTCTGTAGATGGTCT. Left deleted probe: AAGTGAGTTTTTCCGTGTGTTCTGTGGGATCAGGTGCTCCAAATCTTCCA. Right deleted probe: GCGCCAATGCTAATATTATACTTATATAAAAGCACTTAACAAGCTGAGCT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037271 Copy
http://www.wormbase.org/db/get?name=WBStrain00037272
Source Database: WormBase (WB)
Affected Genes: WBGene00012482(clec-106)|WBGene00012487(Y18D10A.23)
Genomic Alteration: WBGene00012482(clec-106), WBGene00012487(Y18D10A.23)
Availability: available
Source References: EMPTY
Synonyms: clec-106&Y18D10A.23(ok3090) I.
Alternate IDs: WB-STRAIN:VC2345, CGC_VC2345
Notes: Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y18D10A.12, Y18D10A.23. External left primer: ACCACGACTGGGAAGTTCAG. External right primer: GCCTAACATCTGCCTTCTCG. Internal left primer: ACTGGATTCTAGGCCCACG. Internal right primer: GTTGCTCCATGCTACGTGAA. Internal WT amplicon: 1318 bp. Deletion size: 724 bp. Deletion left flank: CCTCCGTTTTGGTTTATGATATCGCGGAAG. Deletion right flank: TGCTCTTGAACCCGTCTCTGAACCAATTCA."
Proper citation: RRID:WB-STRAIN:WBStrain00037272 Copy
http://www.wormbase.org/db/get?name=WBStrain00037270
Source Database: WormBase (WB)
Affected Genes: WBGene00008144(gasr-8)
Genomic Alteration: WBGene00008144(gasr-8)
Availability: available
Source References: PMID:38302462
Synonyms: C47E8.6(gk1232) V.
Alternate IDs: WB-STRAIN:VC2343, CGC_VC2343
Notes: C47E8.6. Identified by PCR, validated by CGH. External left primer: CCGTTACCATGCCAACTCTT. External right primer: TGATTTTGGCCGAGTAGGAC. Internal left primer: CCGTCACCTCTTAACGGAAA. Internal right primer: CGAACCAACCAGAATCTTCG. Internal WT amplicon: 1333 bp. Deletion size: 884 bp. Deletion left flank: TTTTGTTTCAGTTTTCATCGTAATTTTTTT. Deletion right flank: TTTCTTGCAGGTAGGAACTCTGAATATTCG.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037270 Copy
http://www.wormbase.org/db/get?name=WBStrain00037275
Source Database: WormBase (WB)
Affected Genes: WBGene00011466(T05C12.1)
Genomic Alteration: WBGene00011466(T05C12.1)
Availability: available
Source References: EMPTY
Synonyms: T05C12.1(ok3101) II.
Alternate IDs: WB-STRAIN:VC2348, CGC_VC2348
Notes: Made_by: Vancouver KO Group|"T05C12.1. External left primer: TTCCCGAGTATAGTCCCGTG. External right primer: CATGTGGATTGATTGTCCCA. Internal left primer: CAAGCAAAACGGTCATCAGA. Internal right primer: TGCTCATCTTGTTTCTTTCATTTT. Internal WT amplicon: 1144 bp. Deletion size: 531 bp. Deletion left flank: GATGCAAATGCTTGGAAAGAATATTGGAGA. Deletion right flank: TTCGTCCAGCCAACACTCCGGATTATACCA. Insertion Sequence: GAAATAGGAAAGAATATT."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037275 Copy
http://www.wormbase.org/db/get?name=WBStrain00037276
Source Database: WormBase (WB)
Affected Genes: WBGene00010723(cpg-7)
Genomic Alteration: WBGene00010723(cpg-7)
Availability: available
Source References: EMPTY
Synonyms: cpg-7(ok3141) II.
Alternate IDs: WB-STRAIN:VC2349, CGC_VC2349
Notes: K09E4.6. External left primer: GAAAAATCTACACCGGCCAA. External right primer: CACCCTGCCTTCTTCACATT. Internal left primer: ATCGGGAGGACTCGAAAAGT. Internal right primer: CAGCTTTTGTCTCAGGCGAT. Internal WT amplicon: 1242 bp. Deletion size: 383 bp. Deletion left flank: AGATGATTCAAGGGTTGCATCACCGGATCC. Deletion right flank: ATATAGGCATATAGGCATATAGGCATATAGGCT.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037276 Copy
http://www.wormbase.org/db/get?name=WBStrain00037273
Source Database: WormBase (WB)
Affected Genes: WBGene00002012(hsp-12.3)
Genomic Alteration: WBGene00002012(hsp-12.3)
Availability: available
Source References: EMPTY
Synonyms: hsp-12.3(ok3095) IV.
Alternate IDs: WB-STRAIN:VC2346, CGC_VC2346
Notes: F38E11.1. External left primer: TAAATCGGCAGAAAACGACC. External right primer: TGTTGCTCTCGAATCGTCAC. Internal left primer: AAAATTGTGGCCACCAAAAA. Internal right primer: ATTTCGTTGCTCATTGGTCC. Internal WT amplicon: 1297 bp. Deletion size: 533 bp. Deletion left flank: TGTTCACCATAAGAAACGAGGCGTCTCCTC. Deletion right flank: AAGGAATTCTCCAATGTTCTTCACATCAAT.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037273 Copy
http://www.wormbase.org/db/get?name=WBStrain00037278
Source Database: WormBase (WB)
Affected Genes: WBGene00019931(R07C12.1)
Genomic Alteration: WBGene00019931(R07C12.1)
Availability: available
Source References: EMPTY
Synonyms: R07C12.1(ok3048) IV/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC2352, CGC_VC2352
Notes: R07C12.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3048 homozygotes (mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GATTTGGAGGCCAGTGTTGT. External right primer: GCCCTGAAACCGAAGTGTAA. Internal left primer: GCTCTGTTTGTAGGCTTGGG. Internal right primer: CAGCATATGGTGGCCAGTAG. Internal WT amplicon: 1301 bp. Deletion size: 537 bp. Deletion left flank: AATTGGTAGTGACTCGTTGAAAATTGTTGA. Deletion right flank: TGGTATACGTTTCTTTAAATTTTTTTTAAT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037278 Copy
http://www.wormbase.org/db/get?name=WBStrain00037282
Source Database: WormBase (WB)
Affected Genes: WBGene00018398(sptl-2)
Genomic Alteration: WBGene00018398(sptl-2)
Availability: available
Source References: EMPTY
Synonyms: sptl-2(ok2753) V.
Alternate IDs: WB-STRAIN:VC2358, CGC_VC2358
Notes: F43H9.2. External left primer: TGAATACCCGGGAACTCGTA. External right primer: GAATAGCCAACGGATGGAGA. Internal left primer: CGTTGGATCCTATAATTATCTTGG. Internal right primer: GGCCGAAATACAGAATCGAA. Internal WT amplicon: 1128 bp. Deletion size: 572 bp. Deletion left flank: GTGCAGAACAATCAGCTTCCAGTATTGATA. Deletion right flank: CTGGAAAGGGAGTCGTTGAGTATTGGGGCT.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037282 Copy
http://www.wormbase.org/db/get?name=WBStrain00037280
Source Database: WormBase (WB)
Affected Genes: WBGene00000156(apr-1)|WBGene00000254(bli-4)
Genomic Alteration: WBGene00000156(apr-1), WBGene00000254(bli-4)
Availability: available
Source References: EMPTY
Synonyms: apr-1(ok2970) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2355, CGC_VC2355
Notes: K04G2.8. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2970 homozygotes (sterile with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGATTTGTGATGGCACAGT. External right primer: GCAGCACCAGAAGTTGATGA. Internal left primer: ATGGTAACGATTTTCCAGCG. Internal right primer: TGGTTCTTCAGCAGTTAATCCA. Internal WT amplicon: 1205 bp. Deletion size: 665 bp. Deletion left flank: TCATCAATTGACGTCTCAACAGCAGAACAC. Deletion right flank: GCTCAGACTGGTCTCCACAACAACAATTAC. Insertion Sequence: AGGACACCCAGCGATCATAACGGCATTGATGTGGCAAGAA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037280 Copy
http://www.wormbase.org/db/get?name=WBStrain00037287
Source Database: WormBase (WB)
Affected Genes: WBGene00008711(F11E6.8)
Genomic Alteration: WBGene00008711(F11E6.8)
Availability: available
Source References: EMPTY
Synonyms: F11E6.8(gk1178) IV.
Alternate IDs: WB-STRAIN:VC2365, CGC_VC2365
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain is homozygous for a deletion (gk1178) in F11E6.8, detectable by PCR using the following primers. External left primer: ACATATTCGACAAGGCACCC. External right primer: CACCCTTCGAGTCTACCCAG. Internal left primer: GCGAGTGAAAGGATCTGGAG. Internal right primer: TGGTGAGGGAATTGGAAAGA. Internal WT amplicon: 2406 bp. Deletion size: 1746 bp. Deletion left flank: ATTTTCCCATTTAGGTATACAAAACTTACA. Deletion right flank: GAGGCAAACTTCTCACTTCTTGAAACATTT. Validation: gk1178 passed by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037287 Copy
http://www.wormbase.org/db/get?name=WBStrain00037284
Source Database: WormBase (WB)
Affected Genes: WBGene00020757(ucr-2.3)
Genomic Alteration: WBGene00020757(ucr-2.3)
Availability: available
Source References: EMPTY
Synonyms: ucr-2.3(ok3073) III.
Alternate IDs: WB-STRAIN:VC2360, CGC_VC2360
Notes: Made_by: Vancouver KO Group|"T24C4.1. External left primer: CGTGCTGGTTCTCGTTATGA. External right primer: CATATGCAGAGATGGCGAGA. Internal left primer: TCACTCAGCCTGGACTTGTG. Internal right primer: TTCTGGACCGTTGTAGAGGG. Internal WT amplicon: 1135 bp. Deletion size: 415 bp. Deletion left flank: GAATTGTGTTTGAGGATATTCATCGCGCTG. Deletion right flank: CTTCTCCACTGAAATTTGCATCACTTCCAG. Insertion Sequence: TTCA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037284 Copy
http://www.wormbase.org/db/get?name=WBStrain00037246
Source Database: WormBase (WB)
Affected Genes: WBGene00022397(Y97E10AR.2)
Genomic Alteration: WBGene00022397(Y97E10AR.2)
Availability: available
Source References: EMPTY
Synonyms: Y97E10AR.2(ok3098) V.
Alternate IDs: WB-STRAIN:VC2310, CGC_VC2310
Notes: Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y97E10AR.2. External left primer: TTGCCGTTCACAGTATCCAA. External right primer: ACGTCGAACTGATCCCCATA. Internal left primer: GAAACTGGTGGAAACGCTGT. Internal right primer: GAACGCTTACGAATAGAAGAGCA. Internal WT amplicon: 1332 bp. Deletion size: 716 bp. Deletion left flank: CATCCGCACACTACAGGACCGGGTTTTGGA. Deletion right flank: ATCATTTCCATCAAACCCAGAATATATTTT."
Proper citation: RRID:WB-STRAIN:WBStrain00037246 Copy
http://www.wormbase.org/db/get?name=WBStrain00037244
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00006059(stc-1)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00006059(stc-1)
Availability: available
Source References: EMPTY
Synonyms: stc-1(ok2829)/mIn1 [mIs14 dpy-10(e128)] II.
Alternate IDs: WB-STRAIN:VC2308, CGC_VC2308
Notes: F54C9.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2829 homozygotes (probable embryonic arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAACCGCCAACGAGTACAAT. External right primer: CAACGGGATCATTGCTAGGT. Internal left primer: GCTAAAGCTGCCGTAATTGG. Internal right primer: TGGATTACCTCCACCACCTC. Internal WT amplicon: 1183 bp. Deletion size: 642 bp. Deletion left flank: TGCTTGAGTTACAAAAACTCCTCCTTGAAG. Deletion right flank: TCATTAAAACTTACAAGAAAGCAACGACAC. Insertion Sequence: TTAAAAC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037244 Copy
http://www.wormbase.org/db/get?name=WBStrain00037245
Source Database: WormBase (WB)
Affected Genes: WBGene00014054(dbt-1)
Genomic Alteration: WBGene00014054(dbt-1)
Availability: available
Source References: EMPTY
Synonyms: ZK669.4(ok3001) II.
Alternate IDs: WB-STRAIN:VC2309, CGC_VC2309
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"ZK669.4. Strain might be sensitive to hypochlorite; no survivors after mutliple attempts to clean by hypochlorite treatment. External left primer: TAGAGTGTTGAAAACGGGGG. External right primer: CCACACCAGCAGTTCGTAGA. Internal left primer: CATCAAGGGATAATTGGGCA. Internal right primer: GGAACTGGAAAAGACGGAAG. Internal WT amplicon: 1181 bp. Deletion size: 401 bp. Deletion left flank: TGTCATGTTTATCGAATCGTGGGAGTTTTT. Deletion right flank: CATTTTCCATTTTCTCATCAGTTGTAGAAT. Insertion Sequence: T."
Proper citation: RRID:WB-STRAIN:WBStrain00037245 Copy
http://www.wormbase.org/db/get?name=WBStrain00037250
Source Database: WormBase (WB)
Affected Genes: WBGene00012597(nhr-235)
Genomic Alteration: WBGene00012597(nhr-235)
Availability: available
Source References: EMPTY
Synonyms: nhr-235(gk1085) II.
Alternate IDs: WB-STRAIN:VC2317, CGC_VC2317
Notes: Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y38E10A.19. External left primer: TTTTTCATTTTGTGTGGCGA. External right primer: AATTCTGTGGAACTCGGTGG. Internal left primer: TGCTTGGTAGCTTTGCTTCA. Internal right primer: GAGTCGTGGAGTCTTGGCAT. Internal WT amplicon: 1867 bp. Deletion size: 935 bp. Deletion left flank: ACTCAAAGCTTACGTTGGAAATTATGTCGG. Deletion right flank: CCGAAAATTTTCAAAAAATTTTAGGATCTA. Insertion Sequence: AAATTTTCCGAAAATTT."
Proper citation: RRID:WB-STRAIN:WBStrain00037250 Copy
http://www.wormbase.org/db/get?name=WBStrain00037254
Source Database: WormBase (WB)
Affected Genes: WBGene00013794(dct-13)
Genomic Alteration: WBGene00013794(dct-13)
Availability: available
Source References: EMPTY
Synonyms: dct-13(gk992) IV.
Alternate IDs: WB-STRAIN:VC2323, CGC_VC2323
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y116A8C.17. External left primer: AGCGAGCATTGCAAAAAGAT. External right primer: TATGAATGTCCGTGCTCTGC. Internal left primer: AAGAGCTGAGCAATGCCAAT. Internal right primer: ACAGCGTTTGTTCCGTATCC. Internal WT amplicon: 785 bp. Deletion size: 94 bp. Deletion left flank: AATTGACACCTGGCTCCGTACTTGCAATAT. Deletion right flank: ATTTGCATGCTTCACCGTAAATGCATGTTT."
Proper citation: RRID:WB-STRAIN:WBStrain00037254 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.