Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Norway

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search
Reset search
On page 160 showing 3181 ~ 3200 out of 122,993 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

http://www.wormbase.org/db/get?name=WBStrain00058296

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37055179
Synonyms: vsIs165 IV; lite-1(ce314) X lin-15(n765ts) X
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00058296 Copy   

http://www.wormbase.org/db/get?name=WBStrain00058330

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37055179
Synonyms: ser-7(gk414345) X lite-1(ce314) X lin-15(n765ts) X; vsEx1043
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00058330 Copy   

http://www.wormbase.org/db/get?name=WBStrain00058294

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37728486
Synonyms: [hsp-16.2p::ss::sfGFP::A + rol-6(su1006)], [emb-9p::emb-9::mCherry + unc-119(+)] X
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00058294 Copy   

http://www.wormbase.org/db/get?name=WBStrain00058292

Source Database: WormBase (WB)
Affected Genes: WBGene00004879(smg-1)
Genomic Alteration: WBGene00004879(smg-1)
Availability: unknown
Source References: PMID:37728486
Synonyms: smg-1(cc546) I; xchEx91.
Notes: Made_by: Eline Jongsma|"xchEx91 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::humanAmyloidBeta1-42(F20S/L35P)::let-858 3UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. Control strain for LSD2104. Upon heat shock, non-sticky form of human amyloid beta is expressed and secreted into the extracellular space. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]"

Proper citation: RRID:WB-STRAIN:WBStrain00058292 Copy   

http://www.wormbase.org/db/get?name=WBStrain00058290

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37713439, PMID:37712432
Synonyms: myo-3(st386) V; stEx30 [myo-3p::GFP::myo-3; rol-6(su1006)]; lstEx1097[azyx-1p::azyx-1(gBlock)::UTR; myo-2p::mCherry]
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00058290 Copy   

http://www.wormbase.org/db/get?name=WBStrain00058315

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37055179
Synonyms: sid-1(qt9) V; lin-15(n765ts) X; vsEx986
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00058315 Copy   

http://www.wormbase.org/db/get?name=WBStrain00058314

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37055179
Synonyms: sid-1(qt9) V; lin-15(n765ts) X; vsIs237; vsEx981
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00058314 Copy   

http://www.wormbase.org/db/get?name=WBStrain00058278

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:36867663
Synonyms: afd-1(cp343[mKate2-C1::3xMyc::AFD-1 + Lox2272]) I; hmp-1(cp20[HMP-1::GFP + LoxP + unc-119(+) LoxP])V
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00058278 Copy   

http://www.wormbase.org/db/get?name=WBStrain00058311

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37055179
Synonyms: tph-1(mg280) II; vsIs165 IV; lite-1(ce314) X nlp-3(tm3023) X
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00058311 Copy   

http://www.wormbase.org/db/get?name=WBStrain00058279

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37713439, PMID:37712432
Synonyms: lstIs26[mcherry::zyx-1; zyx1::GFP]
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00058279 Copy   

    • RRID:WB-STRAIN:WBStrain00058318

http://www.wormbase.org/db/get?name=WBStrain00058318

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37055179
Synonyms: ser-1(ok345) X; vsIs238
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00058318 Copy   

http://www.wormbase.org/db/get?name=WBStrain00058285

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37713439, PMID:37712432
Synonyms: lstIs26[mcherry::zyx-1; zyx1::GFP]; lstEx1089[unc-47p::mCherry; azyx-1p::azyx-1::UTR; myo-2p::mCherry]
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00058285 Copy   

http://www.wormbase.org/db/get?name=WBStrain00058286

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37713439, PMID:37712432
Synonyms: myo-3(st386) V; stEx30 [myo-3p::GFP::myo-3; rol-6(su1006)]; lstEx1090[azyx-1p::azyx-1(gBlock)::UTR; myo-2p::mCherry]
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00058286 Copy   

http://www.wormbase.org/db/get?name=WBStrain00058283

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37713439, PMID:37712432
Synonyms: lstIs26[mcherry::zyx-1; zyx1::GFP]; lstEx1066[azyx-1p::azyx-1(gBlock)::UTR; myo-2p::mCherry]
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00058283 Copy   

http://www.wormbase.org/db/get?name=WBStrain00058284

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37713439, PMID:37712432
Synonyms: lstIs26[mcherry::zyx-1; zyx1::GFP]; lstEx1088[unc-47p::mCherry; myo-2p::mCherry]
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00058284 Copy   

http://www.wormbase.org/db/get?name=WBStrain00058304

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37055179
Synonyms: ser-7(gk414345) X nlp-3(tm3023) X ser-1(ok345) X
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00058304 Copy   

    • RRID:WB-STRAIN:WBStrain00058305

http://www.wormbase.org/db/get?name=WBStrain00058305

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37055179
Synonyms: ser-5(ok3087) I
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00058305 Copy   

http://www.wormbase.org/db/get?name=WBStrain00058300

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37055179
Synonyms: tph-1(mg280) II; nlp-3(tm3023) X
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00058300 Copy   

http://www.wormbase.org/db/get?name=WBStrain00058301

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37055179
Synonyms: ser-7(gk414345) X nlp-3(tm3023) X
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00058301 Copy   

http://www.wormbase.org/db/get?name=WBStrain00058309

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37055179
Synonyms: vsIs165 IV; ser-7(gk414345) X lite-1(ce314) X
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00058309 Copy   

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

dkNET Webinar: A Hormone Cell Atlas Maps the Human Endocrine System at Cellular Resolution

dkNET community events and announcements in October, 2026

Test 10092026

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch