Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
VC2302 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037240 | Caenorhabditis elegans | C52G5(gk1233) X. | C52G5. Identified by PCR, validated by CGH. External left primer: TCTTGGCTTTCTGACGTGTG. External right primer: CGTCGTTGGCAAAGGTAAAT. Internal left primer: GTTGAGTGAGCAATGACGGA. Internal right primer: TGCGAAATTTACGCCATACA. Internal WT amplicon: 2398 bp. Deletion size: 977 bp. Deletion left flank: CAGGAACGATTTGCAAACTTCCTGTATAAT. Deletion right flank: GAAAATATCACTAGATATTCTCTTATTCCT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WB-STRAIN:WBStrain00037240 | WormBase (WB) | WB | available | WB-STRAIN:VC2302, CGC_VC2302 | 2026-08-15 09:33:24 | 0 | |||||
|
VC2303 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037241 | Caenorhabditis elegans | F57A8.1(gk1088) V. | F57A8.1. External left primer: GCAAGTCGAAGAAACTTCCG. External right primer: CAAAATGTCCATCATTCCCC. Internal left primer: TCCGTGCGAAATTATGTTCA. Internal right primer: AACCTTTCCGTTTCATCACG. Internal WT amplicon: 2669 bp. Deletion size: 1244 bp. Deletion left flank: AAAATCGCAGAAACATAACGGGTAGAACAA. Deletion right flank: GATAGTGGGGTCGTGGTGGTGTGGGGGAGG.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00010177(F57A8.1) | WBGene00010177(F57A8.1) | WB-STRAIN:WBStrain00037241 | WormBase (WB) | WB | available | WB-STRAIN:VC2303, CGC_VC2303 | 2026-08-15 09:33:24 | 0 | |||
|
VC2258 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037208 | Caenorhabditis elegans | cbd-1(ok2913) IV. | H02I12.1. External left primer: AAACCAGTAGCCCTCCGTTT. External right primer: TGGATCTTTCCCATTCTTGC. Internal left primer: TGCAGCGATGATTCTGTCTT. Internal right primer: GTCGAGGGATGAAGAATGGA. Internal WT amplicon: 1127 bp. Deletion size: 646 bp. Deletion left flank: ACTACGCCGACGGTTGCAATGACGTATTCT. Deletion right flank: CGTATCTTGAGAATCCATTCTTCATCCCTC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00010351(cbd-1) | WBGene00010351(cbd-1) | WB-STRAIN:WBStrain00037208 | WormBase (WB) | WB | available | PMID:38816072 | WB-STRAIN:VC2258, CGC_VC2258 | 2026-08-15 09:33:23 | 0 | ||
|
VC2260 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037209 | Caenorhabditis elegans | Y54G2A.20(gk1017) IV. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y48G2A.20. External left primer: TCGCAATGAGTGTTCTCCTG. External right primer: CTCATTCCCTGAACTCTCGC. Internal left primer: GGACAGGCCGCATACATATT. Internal right primer: ATCTCAAGAACGTTCACCGC. Internal WT amplicon: 2280 bp. Deletion size: 415 bp. Deletion left flank: TGTCATCCAATAAAACCATTTTGTGAGAGT. Deletion right flank: GGAAATTTCCATCTTCTGATTAGAGGTCAA." | WBGene00021885(Y54G2A.20) | WBGene00021885(Y54G2A.20) | WB-STRAIN:WBStrain00037209 | WormBase (WB) | WB | available | WB-STRAIN:VC2260, CGC_VC2260 | 2026-08-15 09:33:24 | 0 | |||
|
VC2250 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037202 | Caenorhabditis elegans | nstp-3(ok2873) V/nT1 [qIs51] (IV;V). | This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"ZC250.3. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2873 homozygotes (late larval arrest or sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCCTTATCCCAAATTCCCTT. External right primer: CGTTTCATTGGGATACCTGG. Internal left primer: TTTTTGCAAATTTCCATCCG. Internal right primer: AATCTTGGCATCCACCTCAC. Internal WT amplicon: 1225 bp. Deletion size: 429 bp. Deletion left flank: TTAATAGGAAGCTGAGAATGTCAATTTTTG. Deletion right flank: AACTGATGAAAAATGGAAGAATTTAGGAAA." | WBGene00022577(nstp-3) | WBGene00022577(nstp-3) | WB-STRAIN:WBStrain00037202 | WormBase (WB) | WB | available | WB-STRAIN:VC2250, CGC_VC2250 | 2026-08-15 09:33:23 | 0 | |||
|
VC2366 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037288 | Caenorhabditis elegans | unc-22(gk1237gk1238) IV. | Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Unc-22 twitcher. The gk1237 lesion is a point mutation (C to A) with flanks TTCCATATGGATTGGACACCTCGACTGTGT and CTCTCCAGCATCAATGTCCCAAACTTCCTT. The gk1238 lesion is a 122-bp deletion with flanks CTCCATCACTTGCTTCGAATCTATATCTGC and ACGATTTGTGGGCGACTTCCACCGGATTCC, and a single inserted base (C) at the break. Primers to amplify the region are: cggatgcttggaacaaagtt and tgctcgtgtcactggacttc. This strain was isolated after UV/TMP mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to unc-22(gk1237gk1238), it is homozygous for 90 other mutations determined from sequence data. All mutations are annotated in WormBase." | WBGene00006759(unc-22) | WBGene00006759(unc-22) | WB-STRAIN:WBStrain00037288 | WormBase (WB) | WB | available | WB-STRAIN:VC2366, CGC_VC2366 | 2026-08-15 09:33:25 | 0 | |||
|
VC2370 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037289 | Caenorhabditis elegans | nhr-124(gk1074) V. | C17E7.8. External left primer: GAGTTGTTCATGAGCGCAAA. External right primer: TGTTTAAAAGTTGACCCGCC. Internal left primer: TAAGTCGCATTCACGGTTTG. Internal right primer: AGTCACGTCCGTCCAACTTC. Internal WT amplicon: 1629 bp. Deletion size: 895 bp. Deletion left flank: TTTTTAATTAACAAAAAAACATAATAAAAC. Deletion right flank: TGGAGAATAAGAATGTTCTTTCCGGACAAG.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00003714(nhr-124) | WBGene00003714(nhr-124) | WB-STRAIN:WBStrain00037289 | WormBase (WB) | WB | available | WB-STRAIN:VC2370, CGC_VC2370 | 2026-08-15 09:33:25 | 0 | |||
|
VC2255 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037206 | Caenorhabditis elegans | atp-2(ok3002) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | C34E10.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3002 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTGCCACCAAGGTTTGTAT. External right primer: CGGTAAGCTTGTCTTCCTCG. Internal left primer: AGGTCTCTGCCAAGGCTACA. Internal right primer: TTTGAACTCCACGAGCAATG. Internal WT amplicon: 1178 bp. Deletion size: 500 bp. Deletion left flank: CAAGGCTACAGCTGCTAACGCTTCCGGACG. Deletion right flank: GTTACTCTGTGTTCGCTGGAGTCGGAGAGC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000229(atp-2)|WBGene00000254(bli-4) | WBGene00000229(atp-2), WBGene00000254(bli-4) | WB-STRAIN:WBStrain00037206 | WormBase (WB) | WB | available | WB-STRAIN:VC2255, CGC_VC2255 | 2026-08-15 09:33:24 | 0 | |||
|
VC2253 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037204 | Caenorhabditis elegans | spe-17(ok2631) IV. | This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"ZK617.3. External left primer: TGCTGCACCTAACAATCAGC. External right primer: CAAGCGAACAGCAGTCACAT. Internal left primer: GCTTGAATTTTTGACTGTGGC. Internal right primer: GTTGTCGAATTATTGCGGCT. Internal WT amplicon: 1167 bp. Deletion size: 557 bp. Deletion left flank: TTAGCTGAAGTATTGGAAAAATCTCAGAAA. Deletion right flank: TGGTTAGTATTCTGGATGTTTGAGTGAGTA. Insertion Sequence: AAAAAAATCAAAAAAATCTCAAAAAAAAAAAA." | WBGene00004971(spe-17) | WBGene00004971(spe-17) | WB-STRAIN:WBStrain00037204 | WormBase (WB) | WB | available | WB-STRAIN:VC2253, CGC_VC2253 | 2026-08-15 09:33:23 | 0 | |||
|
VC2254 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037205 | Caenorhabditis elegans | ZC395.10(ok2968) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"ZC395.10. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2968 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTTGCCCATGGAAACTGATT. External right primer: CAATGCCATTCGCACTTAAA. Internal left primer: GAAAAACGAATGCGGGATAA. Internal right primer: TCTTGCTTGTTATTGCCGTG. Internal WT amplicon: 1196 bp. Deletion size: 501 bp. Deletion left flank: ATCCGTTCGCCATTCCACCGCCAATTCCGG. Deletion right flank: TAATTCGAAAAGAGAACTAGACGGATACGA." | WBGene00000254(bli-4)|WBGene00022599(daf-41) | WBGene00000254(bli-4), WBGene00022599(daf-41) | WB-STRAIN:WBStrain00037205 | WormBase (WB) | WB | available | WB-STRAIN:VC2254, CGC_VC2254 | 2026-08-15 09:33:23 | 0 | |||
|
VC2374 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037292 | Caenorhabditis elegans | nol-10(ok2965) IV/nT1 [qIs51] (IV;V). | F32E10.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2965 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGAGACATGGCACTTTCAGA. External right primer: TCCAAATCCGAAGCCATATC. Internal left primer: GGATGTTGGCTGACTCCATT. Internal right primer: CAGAGTCGGATGCATCATTG. Internal WT amplicon: 1188 bp. Deletion size: 334 bp. Deletion left flank: TGTCGTTGCTTCTATGGATTCTAGAATGAT. Deletion right flank: CTATACAACAAAGCTCAAACACAAATGCAA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00017989(nol-10) | WBGene00017989(nol-10) | WB-STRAIN:WBStrain00037292 | WormBase (WB) | WB | available | WB-STRAIN:VC2374, CGC_VC2374 | 2026-08-15 09:33:25 | 0 | |||
|
VC2261 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037210 | Caenorhabditis elegans | K10D6.2(ok2876) V. | K10D6.2. External left primer: TTGGAAGTGGGAAGGATGAG. External right primer: CCGAACTCGTCATCCAAAAT. Internal left primer: GCAATGGCTCCTCTCTTCTG. Internal right primer: CAACAACATTGACGAAGATGG. Internal WT amplicon: 1196 bp. Deletion size: 824 bp. Deletion left flank: CTGACGACGATCTTCGTATCTTCTGAAAAC. Deletion right flank: GTGATGTTCTGATTCTCCAGCAGCTCCATC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00010742(clc-6) | WBGene00010742(clc-6) | WB-STRAIN:WBStrain00037210 | WormBase (WB) | WB | available | WB-STRAIN:VC2261, CGC_VC2261 | 2026-08-15 09:33:23 | 0 | |||
|
VC2382 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037298 | Caenorhabditis elegans | ZK930.1(ok3132)/mIn1 [mIs14 dpy-10(e128)] II. | This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"ZK930.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3132 homozygotes (larval arrest). This strain exhibits a high level of sterility or near-sterility in heterozygotes and mIn1 homozygotes, but populations can be maintained. Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GATAGGTGGATGGCTGGAAA. External right primer: CGAAATGTTGGCTCATCTCA. Internal left primer: TCTCCTTGGCTTCTGTGTCC. Internal right primer: GCTCACTTGGCTCTTCGTCT. Internal WT amplicon: 1200 bp. Deletion size: 789 bp. Deletion left flank: TGTCCAACACGGTGCGTTCATAAATTACAA. Deletion right flank: TTGTCCAACATCAGCCCATCGGACGAAACC." | WBGene00001072(dpy-10)|WBGene00014151(vps-15) | WBGene00001072(dpy-10), WBGene00014151(vps-15) | WB-STRAIN:WBStrain00037298 | WormBase (WB) | WB | available | WB-STRAIN:VC2382, CGC_VC2382 | 2026-08-15 09:33:25 | 0 | |||
|
VC2380 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037296 | Caenorhabditis elegans | K10D2.4&cid-1(ok2756) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | K10D2.4, K10D2.3. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2756 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACAACAACCGCGATCTTTTC. External right primer: CATCAATGGTTGTACAGCGG. Internal left primer: AAATCTCAGCGGGAGTTTGA. Internal right primer: CCGGCCTGTAAGTTCAATGT. Internal WT amplicon: 1136 bp. Deletion size: 547 bp. Deletion left flank: TCACTTGCAAGACAGTGTGGCTATTCTGAC. Deletion right flank: AGAAACGCCACTTTTATTTATTTATCAACT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000254(bli-4)|WBGene00019629(cid-1)|WBGene00019630(emb-1) | WBGene00000254(bli-4), WBGene00019629(cid-1), WBGene00019630(emb-1) | WB-STRAIN:WBStrain00037296 | WormBase (WB) | WB | available | WB-STRAIN:VC2380, CGC_VC2380 | 2026-08-15 09:33:25 | 0 | |||
|
VC2371 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037290 | Caenorhabditis elegans | W03B1.2(gk3214) dct-15(gk3215) IV; C47E8.6(gk1082) V; F53H4.5(gk3216) X. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain is homozygous for a deletion (gk1082) in C47E8.6, detectable by PCR using the following primers. External left primer: CCGTTACCATGCCAACTCTT. External right primer: TGATTTTGGCCGAGTAGGAC. Internal left primer: CCGTCACCTCTTAACGGAAA. Internal right primer: CGAACCAACCAGAATCTTCG. Internal WT amplicon: 1333 bp. Deletion size: 468 bp. Deletion left flank: GACCAATGCAGCTTCCCGTCGAAAACCTGC. Deletion right flank: GAATATCTTAAGACAATCTGATGATCTTCT. Validation: gk1082 passed by diagnostic PCR, CGH. Other deletions (gk3214, gk3215, gk3216) identified by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00008144(gasr-8)|WBGene00010010(gmeb-2)|WBGene00012340(dct-15)|WBGene00020972(trpl-2) | WBGene00008144(gasr-8), WBGene00010010(gmeb-2), WBGene00012340(dct-15), WBGene00020972(trpl-2) | WB-STRAIN:WBStrain00037290 | WormBase (WB) | WB | available | WB-STRAIN:VC2371, CGC_VC2371 | 2026-08-15 09:33:25 | 0 | |||
|
VC2273 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037219 | Caenorhabditis elegans | Y105E8B.9(ok3031) I. | Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y105E8B.9. External left primer: TCTTGAGTTGTTCGTGGCTG. External right primer: CCACACAGTACCCTCACTGC. Internal left primer: GGCATGAATTCTCCATCGTC. Internal right primer: TCCCTTTTTAGTTTTACCTACCGA. Internal WT amplicon: 1214 bp. Deletion size: 737 bp. Deletion left flank: CAACTATAAAACACAACACCAAATGTTGAG. Deletion right flank: TACCTCAAATTAAGTAATTTATTTTTCGGT." | WBGene00013693(Y105E8B.9) | WBGene00013693(Y105E8B.9) | WB-STRAIN:WBStrain00037219 | WormBase (WB) | WB | available | WB-STRAIN:VC2273, CGC_VC2273 | 2026-08-15 09:33:24 | 0 | |||
|
VC2271 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037217 | Caenorhabditis elegans | C47E8.6(gk1001) V. | C47E8.6. External left primer: CCGTTACCATGCCAACTCTT. External right primer: TGATTTTGGCCGAGTAGGAC. Internal left primer: CCGTCACCTCTTAACGGAAA. Internal right primer: CGAACCAACCAGAATCTTCG. Internal WT amplicon: 1333 bp. Deletion size: 548 bp. Deletion left flank: AGAAGAAAGAGAGAGAACAAGAGACGTAGA. Deletion right flank: TCAAAATAGTTAAAATATATGATTTGAATT. Insertion Sequence: AATAGTTAAAATATATGATTTGAATT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00008144(gasr-8) | WBGene00008144(gasr-8) | WB-STRAIN:WBStrain00037217 | WormBase (WB) | WB | available | WB-STRAIN:VC2271, CGC_VC2271 | 2026-08-15 09:33:24 | 0 | |||
|
VC2270 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037216 | Caenorhabditis elegans | lap-1(ok2917) III. | This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"ZK353.6. External left primer: GATGTGTGTGGTCAGCTCGT. External right primer: ACCAACGAGGATGCAGTTTT. Internal left primer: CGGGACAATTACTGTTTGAGC. Internal right primer: ATCTCTCAGAATCGGTCCGT. Internal WT amplicon: 1129 bp. Deletion size: 331 bp. Deletion left flank: ATTGAATTGAAGTTAAATATACTTTGCAAT. Deletion right flank: CCAGCCTTCAACAGTTCTTCCCCACGGATC." | WBGene00002249(lap-1) | WBGene00002249(lap-1) | WB-STRAIN:WBStrain00037216 | WormBase (WB) | WB | available | WB-STRAIN:VC2270, CGC_VC2270 | 2026-08-15 09:33:23 | 0 | |||
|
VC2274 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037220 | Caenorhabditis elegans | cky-1(gk1011) V/nT1 [qIs51] (IV;V). | C15C8.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk1011 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCAACATCACCCAACTGGAA. External right primer: ACATGATGACCCTTTAGCGG. Internal left primer: CATCCTGCAGCTCAAGTGAA. Internal right primer: GCTTACACGCATGCCATAAA. Internal WT amplicon: 1542 bp. Deletion size: 516 bp. Deletion left flank: GAGTTCGGGAGGTAGATGGTCAGGGCGTGA. Deletion right flank: TGATTAGGTTTTGACTATTTAAAAAAGCTG.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000521(cky-1) | WBGene00000521(cky-1) | WB-STRAIN:WBStrain00037220 | WormBase (WB) | WB | available | WB-STRAIN:VC2274, CGC_VC2274 | 2026-08-15 09:33:24 | 0 | |||
|
VC2275 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037221 | Caenorhabditis elegans | uev-1(ok2597)/hIn1 [unc-101(sy241)] I. | F39B2.2. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2597 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GAAATGCGTACTCGCACTGA. External right primer: GGAAAAGTTCGAGGGGAAAG. Internal left primer: ACGGATTTATTCGGATGGGT. Internal right primer: TACCGGGGAGAGTAAACTGG. Internal WT amplicon: 1302 bp. Deletion size: 727 bp. Deletion left flank: TTATGGTAACACTTTGTGGCGGGACCAATC. Deletion right flank: ATGTACCACGCAATTTCCGTCTGCTGGAAG. Insertion Sequence: A.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006730(uev-1)|WBGene00006829(unc-101) | WBGene00006730(uev-1), WBGene00006829(unc-101) | WB-STRAIN:WBStrain00037221 | WormBase (WB) | WB | available | WB-STRAIN:VC2275, CGC_VC2275 | 2026-08-15 09:33:24 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
