Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
VC142 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035538 | Caenorhabditis elegans | dgk-2(gk124) X. | F46H6.2. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000959(dgk-2) | WBGene00000959(dgk-2) | WB-STRAIN:WBStrain00035538 | WormBase (WB) | WB | available | WB-STRAIN:VC142, CGC_VC142 | WormBase | 2026-09-26 11:29:13 | 0 | |||
|
VC135 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035531 | Caenorhabditis elegans | tag-4(gk128) I. | Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK337.4. Superficially wild type." | WBGene00006399(tag-4) | WBGene00006399(tag-4) | WB-STRAIN:WBStrain00035531 | WormBase (WB) | WB | available | WB-STRAIN:VC135, CGC_VC135 | WormBase | 2026-09-26 11:29:13 | 0 | |||
|
VC138 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00035534 | Caenorhabditis elegans | elo-1(gk48) IV. | F56H1.4. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001239(elo-1) | WBGene00001239(elo-1) | WB-STRAIN:WBStrain00035534 | WormBase (WB) | WB | available | WB-STRAIN:VC138, CGC_VC138 | WormBase | 2026-09-26 11:29:13 | 1 | |||
|
VC100 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035508 | Caenorhabditis elegans | unc-112(r367) V; gkDf2 X. | gkDf2. Multiple genes deleted. Deletion extents determined by oligo array CGH. Deletion size: ~44kb. Deletion left flank: TTAGTAAGCCGGAAAATGGATTTCGCTTTTCTCCTATTGAGAAACCTAAA. Deletion right flank: CTACCTTTCAAAATGAATAGCAACCACTTTTTCGACGAAGAAATGTTCGT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006836(unc-112) | WBGene00006836(unc-112) | WB-STRAIN:WBStrain00035508 | WormBase (WB) | WB | available | WB-STRAIN:VC100, CGC_VC100 | WormBase | 2026-09-26 11:29:12 | 0 | |||
|
VC107 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035509 | Caenorhabditis elegans | tts-1(gk105) X. | F09E10.10. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006650(tts-1) | WBGene00006650(tts-1) | WB-STRAIN:WBStrain00035509 | WormBase (WB) | WB | available | WB-STRAIN:VC107, CGC_VC107 | WormBase | 2026-09-26 11:29:12 | 0 | |||
|
VC208 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00035584 | Caenorhabditis elegans | cdd-1(ok390) X. | C47D2.2. Superficially wild type.|"Mutagen:UV/TMP"|"Reference WBPaper00059294 added based on published strain data identified by Textpresso literature search."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000391(cdd-1) | WBGene00000391(cdd-1) | WB-STRAIN:WBStrain00035584 | WormBase (WB) | WB | available | PMID:32049015 | WB-STRAIN:VC208, CGC_VC208 | WormBase | 2026-09-26 11:29:13 | 1 | ||
|
VC211 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035587 | Caenorhabditis elegans | ent-3(gk158) V. | K02E11.1. Superficially wild type.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00010510(ent-3) | WBGene00010510(ent-3) | WB-STRAIN:WBStrain00035587 | WormBase (WB) | WB | available | WB-STRAIN:VC211, CGC_VC211 | WormBase | 2026-09-26 11:29:13 | 0 | |||
|
VC217 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035590 | Caenorhabditis elegans | hdl-2(ok440) IV. | C09G9.4. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006409(hdl-2) | WBGene00006409(hdl-2) | WB-STRAIN:WBStrain00035590 | WormBase (WB) | WB | available | WB-STRAIN:VC217, CGC_VC217 | WormBase | 2026-09-26 11:29:13 | 0 | |||
|
VC220 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00035593 | Caenorhabditis elegans | cmk-1(ok287) IV; gkDf56 Y102A5C.36(gk3558) V. | Mutagen:UV/TMP|"This strain is homozygous for a deletion (ok287) in K07A9.2, detectable by PCR using the following primers. External left primer: CAGTGCCTTTAGGGCTTGAG. External right primer: GGGGTACTGTGGCTGAAAAA. Internal left primer: TAAATCAAACGCCCTTGGAA. Internal right primer: AAACGAAAACCCGGAGAAAT. Internal WT amplicon: 2970 bp. Deletion size: 1921 bp. Deletion left flank: TGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCT AGGATCTGGGGTAGGCCTAGGATC. Deletion right flank: GAAATACGGCGTACACACACGATATTCACG. Validation: ok287 passed by CGH. Other deletions (gkDf56 and gk3558) identified by CGH."|"This strain is homozygous for a deletion (ok287) in K07A9.2, detectable by PCR using the following primers. External left primer: CAGTGCCTTTAGGGCTTGAG. External right primer: GGGGTACTGTGGCTGAAAAA. Internal left primer: TAAATCAAACGCCCTTGGAA. Internal right primer: AAACGAAAACCCGGAGAAAT. Internal WT amplicon: 2970 bp. Deletion size: 1921 bp. Deletion left flank: TGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCTAGGATC. Deletion right flank: GAAATACGGCGTACACACACGATATTCACG. Validation: ok287 passed by CGH. Other deletions (gkDf56 and gk3558) identified by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000553(cmk-1)|WBGene00044213(Y102A5C.36) | WBGene00000553(cmk-1), WBGene00044213(Y102A5C.36) | WB-STRAIN:WBStrain00035593 | WormBase (WB) | WB | available | WB-STRAIN:VC220, CGC_VC220 | WormBase | 2026-09-26 11:29:13 | 4 | |||
|
VC117 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00035519 | Caenorhabditis elegans | vab-10(gk45) I. | Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK1151.1a. Superficially wild type." | WBGene00006876(vab-10) | WBGene00006876(vab-10) | WB-STRAIN:WBStrain00035519 | WormBase (WB) | WB | available | PMID:38177158 PMID:38302462 |
WB-STRAIN:VC117, CGC_VC117 | WormBase | 2026-09-26 11:29:12 | 2 | ||
|
VC224 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035596 | Caenorhabditis elegans | octr-1(ok371) X. | F14D12.6. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006411(octr-1) | WBGene00006411(octr-1) | WB-STRAIN:WBStrain00035596 | WormBase (WB) | WB | available | WB-STRAIN:VC224, CGC_VC224 | WormBase | 2026-09-26 11:29:13 | 0 | |||
|
VC109 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035511 | Caenorhabditis elegans | apc-11(gk37)/eT1 III; +/eT1 V. | F35G12.9. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and sterile homozygous gk37 hermaphrodites. Pick WT hermaphrodites and check for correct segregation of progeny to maintain.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000145(apc-11) | WBGene00000145(apc-11) | WB-STRAIN:WBStrain00035511 | WormBase (WB) | WB | available | WB-STRAIN:VC109, CGC_VC109 | WormBase | 2026-09-26 11:29:12 | 0 | |||
|
VC108 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035510 | Caenorhabditis elegans | H32C10(gk36) IV. | H32C10. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WB-STRAIN:WBStrain00035510 | WormBase (WB) | WB | available | WB-STRAIN:VC108, CGC_VC108 | WormBase | 2026-09-26 11:29:12 | 0 | |||||
|
VC226 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00035598 | Caenorhabditis elegans | ida-1(ok409) III. | B0244.2. Slow-growing, and some animals appear sterile or Egl. Tail defects are common, and hermaphrodites can be mistaken for males in extreme cases.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00002048(ida-1) | WBGene00002048(ida-1) | WB-STRAIN:WBStrain00035598 | WormBase (WB) | WB | available | WB-STRAIN:VC226, CGC_VC226 | WormBase | 2026-09-26 11:29:13 | 1 | |||
|
VC110 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035512 | Caenorhabditis elegans | pus-1(gk38) V. | Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"W06H3.2. Superficially wild type." | WBGene00004248(pus-1) | WBGene00004248(pus-1) | WB-STRAIN:WBStrain00035512 | WormBase (WB) | WB | available | WB-STRAIN:VC110, CGC_VC110 | WormBase | 2026-09-26 11:29:12 | 0 | |||
|
VC233 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00035602 | Caenorhabditis elegans | gpn-1(ok377) X. | F59D12.4. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001687(gpn-1) | WBGene00001687(gpn-1) | WB-STRAIN:WBStrain00035602 | WormBase (WB) | WB | available | PMID:38177158 | WB-STRAIN:VC233, CGC_VC233 | WormBase | 2026-09-26 11:29:14 | 1 | ||
|
VC237 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00035605 | Caenorhabditis elegans | emr-1(gk119) I. | M01D7.6. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001309(emr-1) | WBGene00001309(emr-1) | WB-STRAIN:WBStrain00035605 | WormBase (WB) | WB | available | WB-STRAIN:VC237, CGC_VC237 | WormBase | 2026-09-26 11:29:14 | 1 | |||
|
VC235 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035604 | Caenorhabditis elegans | +/mT1 II; pan-1(gk142)/mT1 [dpy-10(e128)] III. | M88.6a. Heterozygotes are WT and segregate WT, arrested mT1 aneuploid progeny, sterile Dpy-10 mT1 homozygotes, and homozygous gk142 hermaphrodites (dpyish L1 or L2 larvae). Pick WT hermaphrodites and check for correct segregation of progeny to maintain.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001072(dpy-10)|WBGene00003915(pan-1) | WBGene00001072(dpy-10), WBGene00003915(pan-1) | WB-STRAIN:WBStrain00035604 | WormBase (WB) | WB | available | WB-STRAIN:VC235, CGC_VC235 | WormBase | 2026-09-26 11:29:14 | 0 | |||
|
VC238 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035606 | Caenorhabditis elegans | sul-1(gk151) X. | K09C4.8. Superficially wild type.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006308(sul-1) | WBGene00006308(sul-1) | WB-STRAIN:WBStrain00035606 | WormBase (WB) | WB | available | WB-STRAIN:VC238, CGC_VC238 | WormBase | 2026-09-26 11:29:14 | 0 | |||
|
VC241 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035609 | Caenorhabditis elegans | fkh-3(ok455) X. | C29F7.4. Superficially wild type.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001435(fkh-3) | WBGene00001435(fkh-3) | WB-STRAIN:WBStrain00035609 | WormBase (WB) | WB | available | WB-STRAIN:VC241, CGC_VC241 | WormBase | 2026-09-26 11:29:14 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.