Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00029020
Source Database: WormBase (WB)
Affected Genes: WBGene00001088(dpy-30)
Genomic Alteration: WBGene00001088(dpy-30)
Availability: unknown
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:NL3848
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00029020 Copy
http://www.wormbase.org/db/get?name=WBStrain00029017
Source Database: WormBase (WB)
Affected Genes: WBGene00001332(eri-1)|WBGene00004027(pie-1)
Genomic Alteration: WBGene00001332(eri-1), WBGene00004027(pie-1)
Availability: available
Synonyms: pkIs32 III; eri-1(mg366) IV.
Alternate IDs: WB-STRAIN:NL3630, CGC_NL3630
Notes: pkIs32[pie-1::GFP::H2B]. RNAi hypersensitive.
Proper citation: RRID:WB-STRAIN:WBStrain00029017 Copy
http://www.wormbase.org/db/get?name=WBStrain00029018
Source Database: WormBase (WB)
Affected Genes: WBGene00006759(unc-22)
Genomic Alteration: WBGene00006759(unc-22)
Availability: available
Source References: PMID:37078421
Synonyms: unc-22(st136) IV.
Alternate IDs: WB-STRAIN:NL3643, CGC_NL3643
Notes: Alt Genotype: unc-22(st136)|"Contains Construct Originally made by Dr. Nadine Vastenhouw."|"The unc-22(st136) allele harbors a transposon insertion. Animals have a twitcher phenotype."|"Twitcher Unc. Flanking sequence: agattgacgagatccataaggaaggatgta cattgaactggaagcctccaactgataacg.Twitcher Unc."
Proper citation: RRID:WB-STRAIN:WBStrain00029018 Copy
http://www.wormbase.org/db/get?name=WBStrain00029014
Source Database: WormBase (WB)
Affected Genes: WBGene00002016(hsp-16.2)
Genomic Alteration: WBGene00002016(hsp-16.2)
Availability: available
Synonyms: pkIs1605.
Alternate IDs: WB-STRAIN:NL3401, CGC_NL3401
Notes: pkIs1605 [hsp-16.2p::GFP::LacZ + rol-6(su1006)]. Rollers.
Proper citation: RRID:WB-STRAIN:WBStrain00029014 Copy
http://www.wormbase.org/db/get?name=WBStrain00029015
Source Database: WormBase (WB)
Affected Genes: WBGene00004093(ppw-1)
Genomic Alteration: WBGene00004093(ppw-1)
Availability: available
Source References: PMID:31717869, PMID:32943454, PMID:36176234, PMID:37865119
Synonyms: ppw-1(pk1425) I.
Alternate IDs: WB-STRAIN:NL3511, CGC_NL3511
Notes: Mutagen:UV/TMP|"ppw-1 animals are resistant to feeding of ds RNA directed against germline genes. The genomic region that is deleted: nt 2479-3982 of C18E3 (intragenic deletion in C18E3.7). This strain was formerly called NL2557."|"Reference WBPaper00058851 added based on published strain data identified by Textpresso literature search."|"Supplementary_genotype [ppw1(pk1425)"|"WBStrain provided so WBPaper00060343 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00029015 Copy
http://www.wormbase.org/db/get?name=WBStrain00029096
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Synonyms: unc-119(ed3) III; cdIs141.
Alternate IDs: WB-STRAIN:NP1154, CGC_NP1154
Notes: cdIs141[pcc1::mCherry::rab-7 + ttx-3::GFP + unc-119(+)]. Ballistic transformation. mCherry::RAB-7 expressed in front coelomocyte promoter.|"cdIs141[pcc1::mCherry::RAB-7 + unc-119(+) + ttx-3::GFP]. Ballistic transformation. mCherry::RAB-7 expressed in front coelomocyte promoter."
Proper citation: RRID:WB-STRAIN:WBStrain00029096 Copy
http://www.wormbase.org/db/get?name=WBStrain00029097
Source Database: WormBase (WB)
Affected Genes: WBGene00013093(cup-14)
Genomic Alteration: WBGene00013093(cup-14)
Availability: available
Synonyms: arIs37 I; cup-14(cd31) II.
Alternate IDs: WB-STRAIN:NP1360, CGC_NP1360
Notes: arIs37 [myo-3p::ssGFP + dpy-20(+)] I. myo-3p::ssGFP is a secreted GFP that is taken up by coelomocytes. Reference: Gee, K et al. (2017) G3 7: 991.|"Made_by: Daniel Zamora"
Proper citation: RRID:WB-STRAIN:WBStrain00029097 Copy
http://www.wormbase.org/db/get?name=WBStrain00029010
Source Database: WormBase (WB)
Affected Genes: WBGene00004683(rsd-4)
Genomic Alteration: WBGene00004683(rsd-4)
Availability: available
Synonyms: rsd-4(pk3304) III.
Alternate IDs: WB-STRAIN:NL3304, CGC_NL3304
Notes: Made_by: K.L. Okihara|"Resistant to feeding dsRNA but sensitive to dsRNA injection."
Proper citation: RRID:WB-STRAIN:WBStrain00029010 Copy
http://www.wormbase.org/db/get?name=WBStrain00029011
Source Database: WormBase (WB)
Affected Genes: WBGene00004681(rsd-2)
Genomic Alteration: WBGene00004681(rsd-2)
Availability: available
Source References: PMID:32338603
Synonyms: rsd-2(pk3307).
Alternate IDs: WB-STRAIN:NL3307, CGC_NL3307
Notes: Made_by: K.L. Okihara|"Resistant when fed dsRNA. Contains a point mutation at position 13832 (c to t) (R1000 STOP)."|"WBStrain mapped, WBPaper00059605 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00029011 Copy
http://www.wormbase.org/db/get?name=WBStrain00029099
Source Database: WormBase (WB)
Affected Genes: WBGene00010191(dmsr-1)
Genomic Alteration: WBGene00010191(dmsr-1)
Availability: available
Synonyms: qnIs303 IV; dmsr-1(qn45) V.
Alternate IDs: WB-STRAIN:NQ792, CGC_NQ792
Notes: Made_by: Mike Iannacone|"qnIs303 [hsp-16.2p::flp-13 + hsp-16.2p::GFP + rab-3p::mCherry] IV. Pumps and moves 2 hours after heat induced flp-13 over-expression. Outcrossed 1x to NQ570. Reference: Iannacone M, et al. eLife 2017."
Proper citation: RRID:WB-STRAIN:WBStrain00029099 Copy
http://www.wormbase.org/db/get?name=WBStrain00025083
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:15310838
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:LS2738
Notes: For further information and strain requests please visit http://ums3421.univ-lyon1.fr/
Proper citation: RRID:WB-STRAIN:WBStrain00025083 Copy
http://www.wormbase.org/db/get?name=WBStrain00025082
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:15310838
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:LS2737
Notes: For further information and strain requests please visit http://ums3421.univ-lyon1.fr/
Proper citation: RRID:WB-STRAIN:WBStrain00025082 Copy
http://www.wormbase.org/db/get?name=WBStrain00025088
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:15310838
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:LS2743
Notes: For further information and strain requests please visit http://ums3421.univ-lyon1.fr/
Proper citation: RRID:WB-STRAIN:WBStrain00025088 Copy
http://www.wormbase.org/db/get?name=WBStrain00025087
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:15310838
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:LS2742
Notes: For further information and strain requests please visit http://ums3421.univ-lyon1.fr/
Proper citation: RRID:WB-STRAIN:WBStrain00025087 Copy
http://www.wormbase.org/db/get?name=WBStrain00025085
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:15310838
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:LS2740
Notes: For further information and strain requests please visit http://ums3421.univ-lyon1.fr/
Proper citation: RRID:WB-STRAIN:WBStrain00025085 Copy
http://www.wormbase.org/db/get?name=WBStrain00025080
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:15310838
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:LS2735
Notes: For further information and strain requests please visit http://ums3421.univ-lyon1.fr/
Proper citation: RRID:WB-STRAIN:WBStrain00025080 Copy
http://www.wormbase.org/db/get?name=WBStrain00025070
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:15310838
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:LS2725
Notes: For further information and strain requests please visit http://ums3421.univ-lyon1.fr/
Proper citation: RRID:WB-STRAIN:WBStrain00025070 Copy
http://www.wormbase.org/db/get?name=WBStrain00025077
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:15310838
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:LS2732
Notes: For further information and strain requests please visit http://ums3421.univ-lyon1.fr/
Proper citation: RRID:WB-STRAIN:WBStrain00025077 Copy
http://www.wormbase.org/db/get?name=WBStrain00025075
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:15310838
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:LS2730
Notes: For further information and strain requests please visit http://ums3421.univ-lyon1.fr/
Proper citation: RRID:WB-STRAIN:WBStrain00025075 Copy
http://www.wormbase.org/db/get?name=WBStrain00025074
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:15310838
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:LS2729
Notes: For further information and strain requests please visit http://ums3421.univ-lyon1.fr/
Proper citation: RRID:WB-STRAIN:WBStrain00025074 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
