Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00037245
Source Database: WormBase (WB)
Affected Genes: WBGene00014054(dbt-1)
Genomic Alteration: WBGene00014054(dbt-1)
Availability: available
Source References: EMPTY
Synonyms: ZK669.4(ok3001) II.
Alternate IDs: WB-STRAIN:VC2309, CGC_VC2309
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"ZK669.4. Strain might be sensitive to hypochlorite; no survivors after mutliple attempts to clean by hypochlorite treatment. External left primer: TAGAGTGTTGAAAACGGGGG. External right primer: CCACACCAGCAGTTCGTAGA. Internal left primer: CATCAAGGGATAATTGGGCA. Internal right primer: GGAACTGGAAAAGACGGAAG. Internal WT amplicon: 1181 bp. Deletion size: 401 bp. Deletion left flank: TGTCATGTTTATCGAATCGTGGGAGTTTTT. Deletion right flank: CATTTTCCATTTTCTCATCAGTTGTAGAAT. Insertion Sequence: T."
Proper citation: RRID:WB-STRAIN:WBStrain00037245 Copy
http://www.wormbase.org/db/get?name=WBStrain00037250
Source Database: WormBase (WB)
Affected Genes: WBGene00012597(nhr-235)
Genomic Alteration: WBGene00012597(nhr-235)
Availability: available
Source References: EMPTY
Synonyms: nhr-235(gk1085) II.
Alternate IDs: WB-STRAIN:VC2317, CGC_VC2317
Notes: Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y38E10A.19. External left primer: TTTTTCATTTTGTGTGGCGA. External right primer: AATTCTGTGGAACTCGGTGG. Internal left primer: TGCTTGGTAGCTTTGCTTCA. Internal right primer: GAGTCGTGGAGTCTTGGCAT. Internal WT amplicon: 1867 bp. Deletion size: 935 bp. Deletion left flank: ACTCAAAGCTTACGTTGGAAATTATGTCGG. Deletion right flank: CCGAAAATTTTCAAAAAATTTTAGGATCTA. Insertion Sequence: AAATTTTCCGAAAATTT."
Proper citation: RRID:WB-STRAIN:WBStrain00037250 Copy
http://www.wormbase.org/db/get?name=WBStrain00037254
Source Database: WormBase (WB)
Affected Genes: WBGene00013794(dct-13)
Genomic Alteration: WBGene00013794(dct-13)
Availability: available
Source References: EMPTY
Synonyms: dct-13(gk992) IV.
Alternate IDs: WB-STRAIN:VC2323, CGC_VC2323
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y116A8C.17. External left primer: AGCGAGCATTGCAAAAAGAT. External right primer: TATGAATGTCCGTGCTCTGC. Internal left primer: AAGAGCTGAGCAATGCCAAT. Internal right primer: ACAGCGTTTGTTCCGTATCC. Internal WT amplicon: 785 bp. Deletion size: 94 bp. Deletion left flank: AATTGACACCTGGCTCCGTACTTGCAATAT. Deletion right flank: ATTTGCATGCTTCACCGTAAATGCATGTTT."
Proper citation: RRID:WB-STRAIN:WBStrain00037254 Copy
http://www.wormbase.org/db/get?name=WBStrain00037251
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00003144(max-2)|WBGene00006787(unc-52)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00003144(max-2), WBGene00006787(unc-52)
Availability: available
Source References: EMPTY
Synonyms: max-2(ok2553)/mnC1 [dpy-10(e128) unc-52(e444)] II.
Alternate IDs: WB-STRAIN:VC2320, CGC_VC2320
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y38F1A.10. Apparent homozygous lethal deletion chromosome balanced by recombination suppressor marked with dpy-10 and unc-52. Heterozygotes are WT and segregate WT, paralyzed Dpy mnC1 homozygotes and ok2553 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGACAGAAATCGACAGCAGG. External right primer: ACGGGAACCCCCATATACTC. Internal left primer: AAGCGGTAAATGACGGAATG. Internal right primer: TGTGTCTGTGTGTCTTCGCA. Internal WT amplicon: 3342 bp. Deletion size: approximately 2000 bp."
Proper citation: RRID:WB-STRAIN:WBStrain00037251 Copy
http://www.wormbase.org/db/get?name=WBStrain00037252
Source Database: WormBase (WB)
Affected Genes: WBGene00001543(gcy-18)
Genomic Alteration: WBGene00001543(gcy-18)
Availability: available
Source References: PMID:21173231
Synonyms: gcy-18(ok3047) IV/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC2321, CGC_VC2321
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"ZK896.8. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3047 homozygotes (sterile, lays eggs that don't hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATCGCTAATCCACTGGAACG. External right primer: CGATCCTCCAACCAGAATGT. Internal left primer: CTGCAAAAGATTCGGACGAT. Internal right primer: GTGCCCTTTCCTTTCACTTG. Internal WT amplicon: 1263 bp. Deletion size: 517 bp. Deletion left flank: TTTCAGCAATAATCTATATGGCTCCTGAAC. Deletion right flank: GAATGTTAGAAGAAGCCAACATCCGTGCTG."
Proper citation: RRID:WB-STRAIN:WBStrain00037252 Copy
http://www.wormbase.org/db/get?name=WBStrain00037257
Source Database: WormBase (WB)
Affected Genes: WBGene00015523(ztf-30)
Genomic Alteration: WBGene00015523(ztf-30)
Availability: available
Source References: PMID:34271120
Synonyms: C06E1.8(gk1061) III.
Alternate IDs: WB-STRAIN:VC2326, CGC_VC2326
Notes: C06E1.8. External left primer: CCCGCAAACAGGAAGAAATA. External right primer: CTGCTGCTCCAAAACATTGA. Internal left primer: GCACAGTTTGTTCCAATCCA. Internal right primer: TTCTTCTTCCTCCTCCGTCA. Internal WT amplicon: 2185 bp. Deletion size: 559 bp. Deletion left flank: ATTATTCAAAGTCCCCAATTCAAATACAGT. Deletion right flank: GTTTTCATTCTATTTCATATTTTTGTCTCC.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain provided so WBPaper00061672 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00037257 Copy
http://www.wormbase.org/db/get?name=WBStrain00037255
Source Database: WormBase (WB)
Affected Genes: WBGene00001449(flp-6)
Genomic Alteration: WBGene00001449(flp-6)
Availability: available
Source References: PMID:38443452
Synonyms: flp-6(ok3056)ZK6.11(ok3738)
Alternate IDs: WB-STRAIN:VC2324, CGC_VC2324
Notes: F07D3.2. External left primer: ACTCCCCCTCATCCAAATTC. External right primer: TTTCGCGAATGAAGCTATGA. Internal left primer: CCCCACGTTACCAGATGATATT. Internal right primer: CCAGTTGGTCCTTACAAGAGC. Internal WT amplicon: 1129 bp. Deletion size: 421 bp. Deletion left flank: TATGTTTTTCTGTTCAACGTTTTTTATTTA. Deletion right flank: GTGGAAACCCAATGGAAATGGAAAAACGGA. Insertion Sequence: A.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037255 Copy
http://www.wormbase.org/db/get?name=WBStrain00037260
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00012662(tmie-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00012662(tmie-1)
Availability: available
Source References: EMPTY
Synonyms: Y39A1C.1(ok3032) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2330, CGC_VC2330
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y39A1C.1. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3032 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCGTGGTGACTCCAAAACTT. External right primer: CTGCGTCTCCTCCTCTTCAC. Internal left primer: TTGGGTTTCCATGGTGACTT. Internal right primer: AAAAACCCGCATCTAACCAC. Internal WT amplicon: 1253 bp. Deletion size: 520 bp. Deletion left flank: CGAACCGTGGTGTCTCCAGGCGGGAATTCA. Deletion right flank: TTTTTGTAAATAAATTGAATTTTTAATATG. Insertion Sequence: TT."
Proper citation: RRID:WB-STRAIN:WBStrain00037260 Copy
http://www.wormbase.org/db/get?name=WBStrain00037261
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00003929(pat-2)
Genomic Alteration: WBGene00000254(bli-4), WBGene00003929(pat-2)
Availability: available
Source References: EMPTY
Synonyms: pat-2(ok2148) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2332, CGC_VC2332
Notes: F54F2.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2148 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCGTCATCGTCTTGGATACG. External right primer: AAGTGAAGTTTGTCAGCCCG. Internal left primer: TCGTGTTTTTATTGGAGCCC. Internal right primer: CGACTATGAGATCGTGGCAA. Internal WT amplicon: 3238 bp. Deletion size: 1660 bp. Deletion left flank: CAGTTGTTGGAGATGATCAGTGGGGACGAT. Deletion right flank: TTTTATAATGAGACAAGTTCACAGCCATTT. Insertion Sequence: GTGGAGTGGAGAGATGTGGAGTGGGGAGTGGGGAGTGGGGA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037261 Copy
http://www.wormbase.org/db/get?name=WBStrain00037264
Source Database: WormBase (WB)
Affected Genes: WBGene00013128(dxbp-1)
Genomic Alteration: WBGene00013128(dxbp-1)
Availability: available
Source References: EMPTY
Synonyms: Y52B11A.9(gk1120) I.
Alternate IDs: WB-STRAIN:VC2336, CGC_VC2336
Notes: Made_by: Vancouver KO Group|"This strain is homozygous for a deletion (gk1120) in Y52B11A.9, detectable by PCR using the following primers. External left primer: CAATCCCCTCTCTCATCCAA. External right primer: TATTTGCAACGACACTCCGA. Internal left primer: TGCATATGACGCTCTTCGTC. Internal right primer: TTCCAGCTTCTGCCAAATGT. Internal WT amplicon: 1563 bp. Deletion size: 405 bp. Deletion left flank: GGAGCTTTTCGGCTCAAATTATTGGAATAT. Deletion right flank: ACAAACTACAAAATTTCTAGCCTCTACCAA. Validation: gk1120 passed by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037264 Copy
http://www.wormbase.org/db/get?name=WBStrain00037265
Source Database: WormBase (WB)
Affected Genes: WBGene00013785(nep-23)
Genomic Alteration: WBGene00013785(nep-23)
Availability: available
Source References: EMPTY
Synonyms: Y116A8C.4(ok3077) IV.
Alternate IDs: WB-STRAIN:VC2337, CGC_VC2337
Notes: Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y116A8C.4. External left primer: CGACGTTGTTTCCAGGATTT. External right primer: TTCCACCCAACTCACATTCA. Internal left primer: GCGCTGAGCTCTCAAAGACT. Internal right primer: GACAAGCCCCATAAAGTCCA. Internal WT amplicon: 1215 bp. Deletion size: 526 bp. Deletion left flank: TGTATCACGCTTGCTCATCAATTGGTAGGA. Deletion right flank: TTTCTTCAAATAGTTATTTTAGAAATGCTC. Insertion Sequence: TCGACATCTTCCGGGTTTCCAGACCCATAAAATGTCGGTTGCTAGATAATAAATCAA."
Proper citation: RRID:WB-STRAIN:WBStrain00037265 Copy
http://www.wormbase.org/db/get?name=WBStrain00037345
Source Database: WormBase (WB)
Affected Genes: WBGene00018202(F39F10.2)|WBGene00020004(R11E3.2)|WBGene00021246(Y22D7AL.7)|WBGene00022773(ZK616.3)
Genomic Alteration: WBGene00018202(F39F10.2), WBGene00020004(R11E3.2), WBGene00021246(Y22D7AL.7), WBGene00022773(ZK616.3)
Availability: available
Source References: EMPTY
Synonyms: Y22D7AL.7(gk3210) III; R11E3.2(gk3211) ZK616.3(gk3212) IV; F39F10.2(gk1161) X.
Alternate IDs: WB-STRAIN:VC2461, CGC_VC2461
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain is homozygous for a deletion (gk1161) in F39F10.2, detectable by PCR using the following primers. External left primer: GTGCTCACCGAGATGTCTGA. External right primer: GCTGATTTCGCTCAACACAA. Internal left primer: GACCCGGTAATTGAGCAGAA. Internal right primer: TGCGAACATTCGTTGAGTTC. Internal WT amplicon: 2489 bp. Deletion size: 500 bp. Deletion left flank: TTCAATTAGGATGTCGTAAACGCAGTGGCT. Deletion right flank: GTGATATCCTAAAAATTATGTTTAAGTTAT. Validation: gk1161 passed by CGH. Other deletions (gk3210, gk3211, gk3212) identified by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037345 Copy
http://www.wormbase.org/db/get?name=WBStrain00037352
Source Database: WormBase (WB)
Affected Genes: WBGene00012792(Y43D4A.6)
Genomic Alteration: WBGene00012792(Y43D4A.6)
Availability: available
Source References: EMPTY
Synonyms: Y43D4A.6(gk1142) IV.
Alternate IDs: WB-STRAIN:VC2476, CGC_VC2476
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y43D4A.6. Identified by PCR, validated by CGH. External left primer: ACGATAAACCAGCAGACGCT. External right primer: TTTGAAAACGGTGTGAAACG. Internal left primer: AACTGTGTTCGAAACCCTCG. Internal right primer: TCAAGCTCATTCGGATTTCA. Internal WT amplicon: 2337 bp. Deletion size: 1390 bp. Deletion left flank: CAAGTTTATCAACAACGTGAAACAGACAAT. Deletion right flank: CAGCAAAAAAATCACTTGCTCCAGTAATTC."
Proper citation: RRID:WB-STRAIN:WBStrain00037352 Copy
http://www.wormbase.org/db/get?name=WBStrain00037353
Source Database: WormBase (WB)
Affected Genes: WBGene00011979(sysm-1)
Genomic Alteration: WBGene00011979(sysm-1)
Availability: available
Source References: PMID:32560629
Synonyms: T24B8.5(ok3236) II.
Alternate IDs: WB-STRAIN:VC2477, CGC_VC2477
Notes: Made_by: Vancouver KO Group|"T24B8.5. External left primer: CCGTCTCTCTCCGTTTTGTT. External right primer: CTACATCCGGCTGCCTATTC. Internal left primer: CTTTTCCGTCCGTTCGATT. Internal right primer: CCCTTGAATGCTTCTGGTTT. Internal WT amplicon: 1299 bp. Deletion size: 509 bp. Deletion left flank: TTTGGGCATTGTCTGAAATTTCAGATGAGA. Deletion right flank: GGTAAAGTTTAGAACAATTGAAGTGACAAA. Insertion Sequence: CTATAAAAACTACGTCAAA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037353 Copy
http://www.wormbase.org/db/get?name=WBStrain00037350
Source Database: WormBase (WB)
Affected Genes: WBGene00017510(nhr-178)
Genomic Alteration: WBGene00017510(nhr-178)
Availability: available
Source References: EMPTY
Synonyms: nhr-178(gk1158) V.
Alternate IDs: WB-STRAIN:VC2474, CGC_VC2474
Notes: F16B4.9. Identified by PCR, validated by CGH. External left primer: ACATCCATCTTTCTGGCGAC. External right primer: TTCGGAGTCACAAGTTGCAG. Internal left primer: GCGCACCCTGAACATAGTTT. Internal right primer: AAATATGGGAGCAGCGTTTG. Internal WT amplicon: 1511 bp. Deletion size: 502 bp. Deletion left flank: ATCTAAAATCGCGCTTTTGATTTTGTTCTG. Deletion right flank: ATATAAACGACTATATTTGCATTGAATTCA. Insertion Sequence: TAAACGACTATATTTGCATTGA.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037350 Copy
http://www.wormbase.org/db/get?name=WBStrain00037351
Source Database: WormBase (WB)
Affected Genes: WBGene00010855(M04C7.4)|WBGene00017803(F26A1.4)
Genomic Alteration: WBGene00010855(M04C7.4), WBGene00017803(F26A1.4)
Availability: available
Source References: EMPTY
Synonyms: M04C7.4(gk3034) I; F26A1.4(gk1160) III.
Alternate IDs: WB-STRAIN:VC2475, CGC_VC2475
Notes: F26A1.4, M04C7.4. The allele gk1160 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: TTTAGGTCTGGCACTACCCG. External right primer: AAAACATTGACACACCTGCG. Internal left primer: AAAGCGGCAGCAGTTAAGAA. Internal right primer: CTACCGGTACTGCCATTCGT. Internal WT amplicon: 1327 bp. Deletion size: 126 bp. Deletion left flank: TCACGGATCGGACTCTTTACCGTGCAATGG. Deletion right flank: TTTTTTAAATTGAAAATGCGAGCATCTAGG. The allele gk3034 was identified by CGH but not confirmed by PCR. Left flanking probe: GTACGGTAAGTTGGCCGAGTTGCATTATTCGTCTCGTTCAAGAGGATAAC. Right flanking probe: CAGGCACGCAGGCGCATCTGCACGTACCATGGCTACTTTAGCTGATGAAC. Left deleted probe: GATTTTATCAGCATACGGGCTCGTAAAAGAGAAGAGGAGACGAGGTTACG. Right deleted probe: CTGTGGCTGCTGTTCCAAATGCCAATCTGGAAATGGGAATTTCGGTAACT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037351 Copy
http://www.wormbase.org/db/get?name=WBStrain00037354
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00017300(rpc-2)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00017300(rpc-2)
Availability: available
Source References: EMPTY
Synonyms: +/mT1 II; F09F7.3(ok3162)/mT1 [dpy-10(e128)] III.
Alternate IDs: WB-STRAIN:VC2479, CGC_VC2479
Notes: F09F7.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3162 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATACCCAACAGCAGGCACTC. External right primer: TTCGACAATTCCGTCATCAA. Internal left primer: TGTTACCTCAAAAGTCAAGGCT. Internal right primer: CGATTGGTTAGAGAACGGGA. Internal WT amplicon: 1204 bp. Deletion size: 794 bp. Deletion left flank: ACGTTTGGAGCTCGCTGGATCATTGCTTTC. Deletion right flank: TGGTGAAAGCCGTCAGAGATTTGAGAAGGT. Insertion Sequence: AT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037354 Copy
http://www.wormbase.org/db/get?name=WBStrain00037359
Source Database: WormBase (WB)
Affected Genes: WBGene00001554(gcy-34)
Genomic Alteration: WBGene00001554(gcy-34)
Availability: available
Source References: EMPTY
Synonyms: gcy-34(ok2953) V.
Alternate IDs: WB-STRAIN:VC2486, CGC_VC2486
Notes: M04G12.3. External left primer: GATTCTGATTTGCTTTCGGG. External right primer: ATCGACCTCAAATTCCGTTG. Internal left primer: CCGCACCTCTTTCATGATCT. Internal right primer: CATTTGCAATTTTATCAATGCTG. Internal WT amplicon: 1184 bp. Deletion size: 668 bp. Deletion left flank: ACTTTGTAAACACCACGAAGAACCACAATT. Deletion right flank: TTTTCACTTGAAGTACAAAAACAGCATTGA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037359 Copy
http://www.wormbase.org/db/get?name=WBStrain00037363
Source Database: WormBase (WB)
Affected Genes: WBGene00016670(ilys-3)
Genomic Alteration: WBGene00016670(ilys-3)
Availability: available
Source References: EMPTY
Synonyms: ilys-3(ok3222) IV.
Alternate IDs: WB-STRAIN:VC2496, CGC_VC2496
Notes: C45G7.3. External left primer: ATGCCAAAATCAAATGCACA. External right primer: CCACCTAAACACTTCCGTCC. Internal left primer: CTCCACTTCCTGTTTGCCAT. Internal right primer: TATGGGGTTTCCTGCAGATT. Internal WT amplicon: 1156 bp. Deletion size: 855 bp. Deletion left flank: TGAACTGTATCTTTGGTAGAATGGGTAGTA. Deletion right flank: CAGGGAGCATGCGAAGTGATGGCTCGTAAC.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037363 Copy
http://www.wormbase.org/db/get?name=WBStrain00037329
Source Database: WormBase (WB)
Affected Genes: WBGene00002040(hum-7)
Genomic Alteration: WBGene00002040(hum-7)
Availability: available
Source References: EMPTY
Synonyms: hum-7(ok3054) I.
Alternate IDs: WB-STRAIN:VC2436, CGC_VC2436
Notes: F56A6.2. External left primer: CCTAAGAAACAGTGGCCGAG. External right primer: TTGACGAGGTTGATGAGCAC. Internal left primer: TTGACGTCACTTCTCTTCCAGA. Internal right primer: CAGGACCTCTCTTGCTAGGC. Internal WT amplicon: 1199 bp. Deletion size: 653 bp. Deletion left flank: CGAACTTTGTAAGATTCACAGCATGAACCT. Deletion right flank: ATAATTTCTACTTATATTCAGTCATATAAA. Insertion Sequence: AATAT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037329 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
